Incidental Mutation 'R4643:Smurf1'
ID351726
Institutional Source Beutler Lab
Gene Symbol Smurf1
Ensembl Gene ENSMUSG00000038780
Gene NameSMAD specific E3 ubiquitin protein ligase 1
Synonyms4930431E10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144876495-144965847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144879369 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 725 (F725L)
Ref Sequence ENSEMBL: ENSMUSP00000098029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085684] [ENSMUST00000100461] [ENSMUST00000110677]
Predicted Effect probably damaging
Transcript: ENSMUST00000085684
AA Change: F728L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082827
Gene: ENSMUSG00000038780
AA Change: F728L

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 731 3.48e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100461
AA Change: F725L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098029
Gene: ENSMUSG00000038780
AA Change: F725L

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 281 313 8.66e-13 SMART
HECTc 392 728 2.72e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110677
AA Change: F754L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106305
Gene: ENSMUSG00000038780
AA Change: F754L

DomainStartEndE-ValueType
C2 14 117 3.03e-15 SMART
low complexity region 185 193 N/A INTRINSIC
WW 235 267 1.06e-7 SMART
WW 307 339 8.66e-13 SMART
HECTc 418 757 3.48e-160 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126822
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin ligase that is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. This protein plays a key roll in the regulation of cell motility, cell signalling, and cell polarity. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for one knock-out allele display increased osteoblast function, bone density, and thickness of the cortical bone in long bones. Mice homozygous for a different knock-out allele are viable and only display gastrulation defects in combination with a Smurf2 knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Smurf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Smurf1 APN 5 144881774 missense probably benign 0.00
IGL01577:Smurf1 APN 5 144893188 missense probably damaging 0.99
IGL02232:Smurf1 APN 5 144886438 missense probably damaging 1.00
IGL02407:Smurf1 APN 5 144884724 missense probably damaging 1.00
IGL02959:Smurf1 APN 5 144899389 missense probably damaging 1.00
IGL02997:Smurf1 APN 5 144898005 nonsense probably null
IGL03227:Smurf1 APN 5 144899182 missense probably damaging 1.00
IGL03293:Smurf1 APN 5 144881799 missense probably benign
R1563:Smurf1 UTSW 5 144882513 missense probably damaging 1.00
R1652:Smurf1 UTSW 5 144880664 missense probably damaging 1.00
R2698:Smurf1 UTSW 5 144883562 unclassified probably benign
R3794:Smurf1 UTSW 5 144901175 critical splice donor site probably null
R4274:Smurf1 UTSW 5 144896775 intron probably benign
R4282:Smurf1 UTSW 5 144882593 missense probably damaging 1.00
R4287:Smurf1 UTSW 5 144891458 missense probably benign 0.00
R4723:Smurf1 UTSW 5 144893184 missense probably damaging 1.00
R5496:Smurf1 UTSW 5 144882593 nonsense probably null
R5702:Smurf1 UTSW 5 144901211 missense possibly damaging 0.96
R5846:Smurf1 UTSW 5 144879380 missense probably damaging 1.00
R6107:Smurf1 UTSW 5 144894504 missense possibly damaging 0.75
R6263:Smurf1 UTSW 5 144881731 missense probably damaging 0.96
R6477:Smurf1 UTSW 5 144889792 missense possibly damaging 0.49
R6548:Smurf1 UTSW 5 144899497 missense probably damaging 1.00
R6584:Smurf1 UTSW 5 144882523 missense probably damaging 0.97
R6981:Smurf1 UTSW 5 144886369 missense possibly damaging 0.69
R7062:Smurf1 UTSW 5 144893546 intron probably null
R7900:Smurf1 UTSW 5 144899373 missense probably damaging 1.00
R8271:Smurf1 UTSW 5 144894087 missense possibly damaging 0.53
R8361:Smurf1 UTSW 5 144883696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACCTGGCTGCGTTTTATTG -3'
(R):5'- TCTTCCGAGGGAGATGAGAC -3'

Sequencing Primer
(F):5'- GGAGCCACCTAGGAAAGTCC -3'
(R):5'- AGATGAGACGCCATGCCC -3'
Posted On2015-10-08