Incidental Mutation 'R4643:Pyroxd1'
ID351731
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142345654-142363257 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 142354741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 199 (S199*)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041852
AA Change: S199*
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: S199*

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153912
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R1319:Pyroxd1 UTSW 6 142359148 missense probably benign 0.33
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4638:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4642:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5359:Pyroxd1 UTSW 6 142361991 missense probably damaging 1.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7056:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTGCCCCTAAAGTGAGC -3'
(R):5'- AGCCCTATGTATTTTCTAATCTGAACA -3'

Sequencing Primer
(F):5'- GCACATAGCAGGCGTTCAG -3'
(R):5'- ACATTCCTGCCTCCTGAAT -3'
Posted On2015-10-08