Incidental Mutation 'R4643:Scaper'
ID351738
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene NameS phase cyclin A-associated protein in the ER
SynonymsD530014O03Rik, Zfp291
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location55549879-55938119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55838179 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 596 (F596V)
Ref Sequence ENSEMBL: ENSMUSP00000149050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037408
AA Change: F602V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: F602V

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214747
AA Change: F596V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect possibly damaging
Transcript: ENSMUST00000217647
AA Change: F602V

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55859859 missense probably damaging 0.99
IGL00912:Scaper APN 9 55685955 missense probably damaging 1.00
IGL01469:Scaper APN 9 55859767 missense probably damaging 1.00
IGL01626:Scaper APN 9 55912051 missense possibly damaging 0.61
IGL01779:Scaper APN 9 55892240 missense probably benign 0.20
IGL02011:Scaper APN 9 55580322 missense probably damaging 1.00
IGL02997:Scaper APN 9 55815499 missense probably damaging 1.00
IGL03107:Scaper APN 9 55858402 splice site probably benign
IGL03167:Scaper APN 9 55859824 missense probably damaging 1.00
IGL03293:Scaper APN 9 55874823 missense probably benign
IGL03340:Scaper APN 9 55602832 missense possibly damaging 0.88
IGL03368:Scaper APN 9 55656027 missense possibly damaging 0.53
R0111:Scaper UTSW 9 55602790 missense probably benign 0.01
R0510:Scaper UTSW 9 55758062 splice site probably benign
R0531:Scaper UTSW 9 55609874 missense possibly damaging 0.91
R0558:Scaper UTSW 9 55685923 missense probably benign 0.08
R0605:Scaper UTSW 9 55815518 splice site probably benign
R0646:Scaper UTSW 9 55758056 missense probably damaging 1.00
R0837:Scaper UTSW 9 55859042 nonsense probably null
R1440:Scaper UTSW 9 55602918 nonsense probably null
R1548:Scaper UTSW 9 55816670 missense probably damaging 1.00
R1777:Scaper UTSW 9 55864546 missense probably benign 0.33
R1822:Scaper UTSW 9 55859900 missense probably damaging 0.99
R1834:Scaper UTSW 9 55816734 missense possibly damaging 0.90
R1870:Scaper UTSW 9 55685938 missense probably damaging 1.00
R2102:Scaper UTSW 9 55912050 missense probably benign 0.43
R2168:Scaper UTSW 9 55743639 missense probably damaging 1.00
R2174:Scaper UTSW 9 55859037 missense probably null 0.01
R3690:Scaper UTSW 9 55883921 missense probably benign 0.00
R4392:Scaper UTSW 9 55858115 missense probably damaging 0.99
R4418:Scaper UTSW 9 55838180 missense probably damaging 1.00
R4606:Scaper UTSW 9 55655903 critical splice donor site probably null
R4665:Scaper UTSW 9 55912055 missense probably damaging 1.00
R4739:Scaper UTSW 9 55743648 missense probably damaging 1.00
R4921:Scaper UTSW 9 55892235 missense probably benign 0.02
R4934:Scaper UTSW 9 55809175 missense probably damaging 1.00
R4956:Scaper UTSW 9 55838142 missense probably damaging 1.00
R5055:Scaper UTSW 9 55859719 intron probably null
R5107:Scaper UTSW 9 55580332 missense probably damaging 1.00
R5155:Scaper UTSW 9 55556086 missense probably null 1.00
R5265:Scaper UTSW 9 55864546 missense probably benign
R5408:Scaper UTSW 9 55586224 missense probably damaging 0.99
R5623:Scaper UTSW 9 55864507 missense probably benign 0.02
R5665:Scaper UTSW 9 55807632 missense probably damaging 1.00
R5748:Scaper UTSW 9 55859076 critical splice acceptor site probably null
R5771:Scaper UTSW 9 55816791 missense probably damaging 1.00
R6534:Scaper UTSW 9 55883976 missense probably benign 0.00
R6557:Scaper UTSW 9 55550850 missense probably benign 0.02
R6651:Scaper UTSW 9 55858504 missense probably benign 0.05
R6796:Scaper UTSW 9 55864427 missense probably benign 0.00
R6962:Scaper UTSW 9 55859771 missense probably benign 0.01
R7145:Scaper UTSW 9 55912111 missense unknown
R7199:Scaper UTSW 9 55838176 nonsense probably null
R7356:Scaper UTSW 9 55892211 missense unknown
R7426:Scaper UTSW 9 55762277 nonsense probably null
R7503:Scaper UTSW 9 55807754 missense probably damaging 0.98
R7844:Scaper UTSW 9 55815448 missense probably benign 0.04
R7966:Scaper UTSW 9 55762327 missense probably damaging 0.98
R7992:Scaper UTSW 9 55858154 missense probably benign 0.02
R8081:Scaper UTSW 9 55916046 missense unknown
R8189:Scaper UTSW 9 55912120 missense probably damaging 1.00
R8294:Scaper UTSW 9 55609996 missense possibly damaging 0.62
R8351:Scaper UTSW 9 55816804 missense possibly damaging 0.92
X0012:Scaper UTSW 9 55655930 missense probably damaging 0.98
X0052:Scaper UTSW 9 55816664 missense probably damaging 1.00
Z1176:Scaper UTSW 9 55556248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGCAGAAATCTTTGGAATAG -3'
(R):5'- AAGGAAGCTGTAGTTCTGGCTATG -3'

Sequencing Primer
(F):5'- GTGCAGCTTATCCTGTCAAGTAGATC -3'
(R):5'- AAGCTGTAGTTCTGGCTATGTAGTAG -3'
Posted On2015-10-08