Incidental Mutation 'R4643:Iqch'
ID351739
Institutional Source Beutler Lab
Gene Symbol Iqch
Ensembl Gene ENSMUSG00000037801
Gene NameIQ motif containing H
Synonyms4921504K03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location63421455-63602493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63594802 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000079370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042322] [ENSMUST00000080527] [ENSMUST00000163624] [ENSMUST00000163982] [ENSMUST00000171243]
Predicted Effect probably benign
Transcript: ENSMUST00000042322
AA Change: T40A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047953
Gene: ENSMUSG00000037801
AA Change: T40A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080527
AA Change: T40A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079370
Gene: ENSMUSG00000037801
AA Change: T40A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163624
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128482
Gene: ENSMUSG00000037801
AA Change: T40A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163982
AA Change: T40A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126546
Gene: ENSMUSG00000037801
AA Change: T40A

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170960
Predicted Effect probably benign
Transcript: ENSMUST00000171243
AA Change: T40A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131828
Gene: ENSMUSG00000037801
AA Change: T40A

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
IQ 366 388 2.79e0 SMART
low complexity region 440 452 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Iqch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Iqch APN 9 63480654 missense probably damaging 0.96
IGL01472:Iqch APN 9 63547934 missense probably benign 0.02
IGL01553:Iqch APN 9 63500917 missense probably benign 0.00
IGL01611:Iqch APN 9 63496237 critical splice acceptor site probably null
IGL02608:Iqch APN 9 63421828 unclassified probably benign
IGL03060:Iqch APN 9 63524914 missense probably damaging 1.00
IGL03154:Iqch APN 9 63454682 missense probably damaging 0.97
museum UTSW 9 63525139 nonsense probably null
I2288:Iqch UTSW 9 63500890 missense probably benign 0.01
R0002:Iqch UTSW 9 63594743 splice site probably benign
R0350:Iqch UTSW 9 63500876 missense probably benign 0.43
R0532:Iqch UTSW 9 63508232 splice site probably benign
R0629:Iqch UTSW 9 63425382 missense probably benign 0.22
R0710:Iqch UTSW 9 63525136 missense probably benign
R0766:Iqch UTSW 9 63482683 missense probably benign 0.02
R1797:Iqch UTSW 9 63588377 missense possibly damaging 0.58
R1856:Iqch UTSW 9 63534337 splice site probably null
R1954:Iqch UTSW 9 63548016 missense probably benign 0.00
R1955:Iqch UTSW 9 63548016 missense probably benign 0.00
R2184:Iqch UTSW 9 63525069 missense probably damaging 0.99
R2264:Iqch UTSW 9 63512299 missense probably benign 0.27
R4614:Iqch UTSW 9 63482581 missense probably benign
R4654:Iqch UTSW 9 63524913 missense probably damaging 0.99
R4665:Iqch UTSW 9 63445571 missense probably damaging 1.00
R5027:Iqch UTSW 9 63525012 missense possibly damaging 0.87
R5042:Iqch UTSW 9 63496234 missense possibly damaging 0.48
R5551:Iqch UTSW 9 63496253 splice site probably null
R5829:Iqch UTSW 9 63425357 critical splice donor site probably null
R5878:Iqch UTSW 9 63547990 missense probably damaging 0.99
R6816:Iqch UTSW 9 63480759 missense probably benign 0.02
R6930:Iqch UTSW 9 63480574 missense possibly damaging 0.79
R7000:Iqch UTSW 9 63454610 missense probably benign
R7026:Iqch UTSW 9 63525139 nonsense probably null
R7066:Iqch UTSW 9 63524745 missense probably benign 0.24
R7111:Iqch UTSW 9 63512317 missense possibly damaging 0.79
R7129:Iqch UTSW 9 63421909 missense probably benign 0.09
R7177:Iqch UTSW 9 63421835 makesense probably null
R7252:Iqch UTSW 9 63512236 critical splice donor site probably null
R7485:Iqch UTSW 9 63508317 missense possibly damaging 0.47
R7541:Iqch UTSW 9 63445521 missense possibly damaging 0.95
R7805:Iqch UTSW 9 63421720 splice site probably null
R7973:Iqch UTSW 9 63524946 missense possibly damaging 0.79
R8113:Iqch UTSW 9 63454573 missense probably benign 0.00
R8170:Iqch UTSW 9 63429030 missense probably damaging 1.00
R8218:Iqch UTSW 9 63482633 missense possibly damaging 0.60
X0066:Iqch UTSW 9 63429058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAAGAAAGGTCTGGTGGCCA -3'
(R):5'- AACCTCGCAACAGGTAGAC -3'

Sequencing Primer
(F):5'- ACCCTAAGCCAAGCTCTGC -3'
(R):5'- CCTCGCAACAGGTAGACAATGTG -3'
Posted On2015-10-08