Incidental Mutation 'R0270:Kif1a'
ID35174
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission 038496-MU
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R0270 (G1)
Quality Score154
Status Validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 93054442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
Predicted Effect probably benign
Transcript: ENSMUST00000086819
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112958
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171556
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171796
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect probably benign
Transcript: ENSMUST00000190723
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 unclassified probably null
R5073:Kif1a UTSW 1 93022505 missense probably damaging 1.00
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
R7681:Kif1a UTSW 1 93054944 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGCTGTGAAGCAGAGCCCAG -3'
(R):5'- CGCCATCAGTGTGGAGCTAAAGAAG -3'

Sequencing Primer
(F):5'- TTTCTTTCCCCAGAGAAACAGAG -3'
(R):5'- GTCAACAAGCggggggg -3'
Posted On2013-05-09