Incidental Mutation 'R4643:Olfr807'
ID351742
Institutional Source Beutler Lab
Gene Symbol Olfr807
Ensembl Gene ENSMUSG00000050478
Gene Nameolfactory receptor 807
SynonymsMOR117-1, GA_x6K02T2PULF-11434134-11433199
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129754092-129757793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129754955 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 165 (E165G)
Ref Sequence ENSEMBL: ENSMUSP00000150657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059038] [ENSMUST00000213379] [ENSMUST00000217106]
Predicted Effect probably damaging
Transcript: ENSMUST00000059038
AA Change: E165G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049924
Gene: ENSMUSG00000050478
AA Change: E165G

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 3.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 302 3.4e-8 PFAM
Pfam:7tm_1 39 296 2.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213379
AA Change: E165G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217106
AA Change: E165G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Olfr807
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Olfr807 APN 10 129754655 missense possibly damaging 0.87
IGL03031:Olfr807 APN 10 129755369 missense possibly damaging 0.94
R0691:Olfr807 UTSW 10 129755402 missense probably damaging 1.00
R0848:Olfr807 UTSW 10 129755208 missense probably benign 0.00
R0988:Olfr807 UTSW 10 129754997 missense probably benign 0.03
R1880:Olfr807 UTSW 10 129755421 missense probably benign 0.09
R1894:Olfr807 UTSW 10 129755074 nonsense probably null
R1935:Olfr807 UTSW 10 129754715 missense probably damaging 1.00
R2513:Olfr807 UTSW 10 129755152 missense probably damaging 1.00
R4201:Olfr807 UTSW 10 129754628 missense probably damaging 1.00
R4651:Olfr807 UTSW 10 129755418 missense probably benign
R4652:Olfr807 UTSW 10 129755418 missense probably benign
R4797:Olfr807 UTSW 10 129754521 missense probably benign 0.06
R5337:Olfr807 UTSW 10 129754534 nonsense probably null
R5597:Olfr807 UTSW 10 129754886 missense probably damaging 1.00
R6310:Olfr807 UTSW 10 129754659 missense probably benign 0.04
R6442:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6443:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6642:Olfr807 UTSW 10 129755363 missense probably damaging 1.00
R7660:Olfr807 UTSW 10 129754563 nonsense probably null
R7862:Olfr807 UTSW 10 129755355 missense probably benign 0.00
Z1088:Olfr807 UTSW 10 129755339 missense possibly damaging 0.77
Z1176:Olfr807 UTSW 10 129754688 missense probably damaging 1.00
Z1176:Olfr807 UTSW 10 129754824 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACAGGTGGAGAAGGCCTTC -3'
(R):5'- GCCTTTATCTTTGGCATAGCAC -3'

Sequencing Primer
(F):5'- AAGGCCTTCTTCTGCTGCTGAG -3'
(R):5'- GGCATAGCACAGTTTTTCTTGC -3'
Posted On2015-10-08