Incidental Mutation 'R4643:4833420G17Rik'
ID351745
Institutional Source Beutler Lab
Gene Symbol 4833420G17Rik
Ensembl Gene ENSMUSG00000062822
Gene NameRIKEN cDNA 4833420G17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location119462768-119486120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119474860 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 398 (N398D)
Ref Sequence ENSEMBL: ENSMUSP00000153079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect probably damaging
Transcript: ENSMUST00000026519
AA Change: N398D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822
AA Change: N398D

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048965
Predicted Effect probably damaging
Transcript: ENSMUST00000224312
AA Change: N398D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000225186
AA Change: N398D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in 4833420G17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:4833420G17Rik APN 13 119466958 critical splice donor site probably null
IGL01555:4833420G17Rik APN 13 119473907 missense probably benign 0.10
IGL02395:4833420G17Rik APN 13 119480960 missense probably damaging 1.00
IGL02725:4833420G17Rik APN 13 119474909 missense possibly damaging 0.95
IGL02904:4833420G17Rik APN 13 119484454 missense probably damaging 1.00
IGL03126:4833420G17Rik APN 13 119481027 missense probably benign 0.23
R0410:4833420G17Rik UTSW 13 119469732 missense probably benign
R0437:4833420G17Rik UTSW 13 119470095 missense probably benign 0.35
R0513:4833420G17Rik UTSW 13 119469659 missense probably benign 0.13
R0569:4833420G17Rik UTSW 13 119484480 missense possibly damaging 0.94
R0788:4833420G17Rik UTSW 13 119473932 nonsense probably null
R1495:4833420G17Rik UTSW 13 119477820 missense probably benign 0.17
R1617:4833420G17Rik UTSW 13 119466937 missense probably damaging 1.00
R1905:4833420G17Rik UTSW 13 119469680 missense possibly damaging 0.92
R1914:4833420G17Rik UTSW 13 119485850 missense possibly damaging 0.90
R2169:4833420G17Rik UTSW 13 119485813 missense probably benign 0.09
R4238:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4240:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4295:4833420G17Rik UTSW 13 119469713 missense probably benign 0.02
R4469:4833420G17Rik UTSW 13 119469809 missense probably damaging 1.00
R4964:4833420G17Rik UTSW 13 119474221 intron probably benign
R4966:4833420G17Rik UTSW 13 119474221 intron probably benign
R5093:4833420G17Rik UTSW 13 119474037 utr 3 prime probably benign
R5384:4833420G17Rik UTSW 13 119469960 missense probably benign 0.01
R6255:4833420G17Rik UTSW 13 119466123 missense possibly damaging 0.95
R6491:4833420G17Rik UTSW 13 119475972 missense probably damaging 1.00
R6564:4833420G17Rik UTSW 13 119486077 splice site probably null
R7023:4833420G17Rik UTSW 13 119473907 missense probably benign 0.10
R7574:4833420G17Rik UTSW 13 119469942 missense probably damaging 0.99
Z1176:4833420G17Rik UTSW 13 119477808 missense not run
Z1177:4833420G17Rik UTSW 13 119477808 missense not run
Predicted Primers PCR Primer
(F):5'- CTTACTGGGAGATAAGAGCCAG -3'
(R):5'- GCCAGAAATGCTCTTGTAATGAC -3'

Sequencing Primer
(F):5'- GGCATCCTAAAAGTCATGTCTCTG -3'
(R):5'- AACTTGTCAGATTTGTAGCAAAGAC -3'
Posted On2015-10-08