Incidental Mutation 'R4643:Lrp12'
ID351746
Institutional Source Beutler Lab
Gene Symbol Lrp12
Ensembl Gene ENSMUSG00000022305
Gene Namelow density lipoprotein-related protein 12
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location39870589-39943994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39872022 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 838 (L838Q)
Ref Sequence ENSEMBL: ENSMUSP00000105934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022916] [ENSMUST00000110305]
Predicted Effect probably damaging
Transcript: ENSMUST00000022916
AA Change: L857Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022916
Gene: ENSMUSG00000022305
AA Change: L857Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
CUB 47 159 3.23e-28 SMART
LDLa 167 202 1.27e-11 SMART
LDLa 214 256 1.04e-7 SMART
CUB 259 372 9.88e-24 SMART
LDLa 374 412 2.6e-3 SMART
LDLa 413 450 2.36e-6 SMART
LDLa 451 487 5.1e-11 SMART
low complexity region 630 646 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110305
AA Change: L838Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105934
Gene: ENSMUSG00000022305
AA Change: L838Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 28 140 3.23e-28 SMART
LDLa 148 183 1.27e-11 SMART
LDLa 195 237 1.04e-7 SMART
CUB 240 353 9.88e-24 SMART
LDLa 355 393 2.6e-3 SMART
LDLa 394 431 2.36e-6 SMART
LDLa 432 468 5.1e-11 SMART
low complexity region 611 627 N/A INTRINSIC
low complexity region 634 645 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low-density lipoprotein receptor related protein family. The product of this gene is a transmembrane protein that is differentially expressed in many cancer cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Lrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Lrp12 APN 15 39878101 missense probably damaging 1.00
IGL02501:Lrp12 APN 15 39877904 missense probably damaging 1.00
IGL02850:Lrp12 APN 15 39878575 missense probably damaging 1.00
IGL03365:Lrp12 APN 15 39872521 missense probably benign
R0010:Lrp12 UTSW 15 39878276 missense probably damaging 1.00
R0047:Lrp12 UTSW 15 39878239 missense probably damaging 1.00
R0416:Lrp12 UTSW 15 39878911 splice site probably benign
R0840:Lrp12 UTSW 15 39876158 missense probably damaging 1.00
R1053:Lrp12 UTSW 15 39877981 missense probably damaging 1.00
R1158:Lrp12 UTSW 15 39878431 missense probably damaging 1.00
R1288:Lrp12 UTSW 15 39878403 missense probably damaging 1.00
R1350:Lrp12 UTSW 15 39878250 nonsense probably null
R1416:Lrp12 UTSW 15 39878623 missense probably damaging 1.00
R1548:Lrp12 UTSW 15 39872506 missense probably damaging 0.99
R1691:Lrp12 UTSW 15 39872265 missense probably damaging 1.00
R1696:Lrp12 UTSW 15 39878361 missense probably damaging 0.99
R2050:Lrp12 UTSW 15 39872589 missense probably damaging 0.99
R2513:Lrp12 UTSW 15 39876111 missense probably damaging 1.00
R3415:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R3417:Lrp12 UTSW 15 39878282 missense probably damaging 1.00
R4118:Lrp12 UTSW 15 39877965 nonsense probably null
R4167:Lrp12 UTSW 15 39885013 missense probably damaging 1.00
R4214:Lrp12 UTSW 15 39872580 missense probably benign 0.33
R5008:Lrp12 UTSW 15 39878456 missense probably damaging 1.00
R5061:Lrp12 UTSW 15 39878254 missense probably damaging 1.00
R5165:Lrp12 UTSW 15 39872461 missense probably benign
R5910:Lrp12 UTSW 15 39876043 intron probably null
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6038:Lrp12 UTSW 15 39872380 missense probably damaging 0.99
R6047:Lrp12 UTSW 15 39872067 missense probably damaging 1.00
R6351:Lrp12 UTSW 15 39878188 missense probably damaging 1.00
R6392:Lrp12 UTSW 15 39872019 missense probably damaging 1.00
R7026:Lrp12 UTSW 15 39880170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGCTCCTAGAGTTACACATTG -3'
(R):5'- GAGCTTCGGACATTGATGCC -3'

Sequencing Primer
(F):5'- CATTGTTAAATTTAACCATGCAGGC -3'
(R):5'- ATTGATGCCAATGACTGCTCCAG -3'
Posted On2015-10-08