Incidental Mutation 'R4643:Trip10'
ID351749
Institutional Source Beutler Lab
Gene Symbol Trip10
Ensembl Gene ENSMUSG00000019487
Gene Namethyroid hormone receptor interactor 10
SynonymsCip4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57249455-57263665 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 57261658 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 416 (E416*)
Ref Sequence ENSEMBL: ENSMUSP00000153467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019631] [ENSMUST00000224152] [ENSMUST00000224885] [ENSMUST00000224947]
Predicted Effect probably null
Transcript: ENSMUST00000019631
AA Change: E416*
SMART Domains Protein: ENSMUSP00000019631
Gene: ENSMUSG00000019487
AA Change: E416*

DomainStartEndE-ValueType
FCH 1 94 9.95e-29 SMART
coiled coil region 117 197 N/A INTRINSIC
low complexity region 310 318 N/A INTRINSIC
PDB:2KE4|A 332 425 3e-35 PDB
low complexity region 433 455 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
SH3 489 546 2.44e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224152
AA Change: E472*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224261
Predicted Effect probably null
Transcript: ENSMUST00000224885
AA Change: E472*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224904
Predicted Effect probably null
Transcript: ENSMUST00000224947
AA Change: E416*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin-stimulated glucose uptake in adipocytes and decreased circulating glucose levels. Mice homozygous for another knock-out allele exhibit impaired integrin-dependent T-cell trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Trip10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Trip10 APN 17 57254332 missense possibly damaging 0.91
IGL01639:Trip10 APN 17 57254165 unclassified probably benign
IGL01758:Trip10 APN 17 57261409 missense possibly damaging 0.51
IGL02184:Trip10 APN 17 57257272 missense probably damaging 1.00
IGL02554:Trip10 APN 17 57263135 missense probably damaging 0.99
IGL02641:Trip10 APN 17 57262411 missense probably benign 0.06
R0092:Trip10 UTSW 17 57250798 missense possibly damaging 0.46
R0139:Trip10 UTSW 17 57261633 splice site probably null
R0179:Trip10 UTSW 17 57262349 splice site probably benign
R1173:Trip10 UTSW 17 57253363 missense probably damaging 0.98
R1416:Trip10 UTSW 17 57250800 missense probably damaging 1.00
R2223:Trip10 UTSW 17 57263039 missense possibly damaging 0.70
R2259:Trip10 UTSW 17 57255135 missense probably benign 0.00
R3950:Trip10 UTSW 17 57253411 critical splice donor site probably null
R4420:Trip10 UTSW 17 57255448 missense probably benign 0.05
R4940:Trip10 UTSW 17 57263017 missense possibly damaging 0.65
R5189:Trip10 UTSW 17 57261288 critical splice acceptor site probably null
R5595:Trip10 UTSW 17 57262460 missense probably damaging 1.00
R5946:Trip10 UTSW 17 57250963 missense probably damaging 0.99
R6613:Trip10 UTSW 17 57255197 intron probably null
R6738:Trip10 UTSW 17 57256899 missense probably benign
R6948:Trip10 UTSW 17 57262448 missense probably damaging 1.00
R6994:Trip10 UTSW 17 57255331 missense probably damaging 1.00
R7489:Trip10 UTSW 17 57250966 missense probably damaging 1.00
R7729:Trip10 UTSW 17 57262442 missense probably damaging 1.00
R7750:Trip10 UTSW 17 57261667 missense possibly damaging 0.58
R8260:Trip10 UTSW 17 57257314 missense probably benign
RF024:Trip10 UTSW 17 57255045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATGAGTCACTGTGGGGT -3'
(R):5'- AAAGACAGGAGCATGACCCC -3'

Sequencing Primer
(F):5'- CACTGTGGGGTGGGGGAC -3'
(R):5'- GAGATTCTAGGCCAGTGCTATACC -3'
Posted On2015-10-08