Incidental Mutation 'R4643:Ccdc87'
ID351750
Institutional Source Beutler Lab
Gene Symbol Ccdc87
Ensembl Gene ENSMUSG00000067872
Gene Namecoiled-coil domain containing 87
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4839366-4842528 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4841849 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 790 (G790R)
Ref Sequence ENSEMBL: ENSMUSP00000086028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037246] [ENSMUST00000088653]
Predicted Effect probably benign
Transcript: ENSMUST00000037246
SMART Domains Protein: ENSMUSP00000035486
Gene: ENSMUSG00000034108

DomainStartEndE-ValueType
Pfam:HMA 15 72 2.4e-12 PFAM
Pfam:Sod_Cu 93 230 6.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088653
AA Change: G790R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086028
Gene: ENSMUSG00000067872
AA Change: G790R

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 287 296 N/A INTRINSIC
low complexity region 326 341 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
Pfam:MAP65_ASE1 669 855 2.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
R3hcc1l G T 19: 42,562,800 V79F probably benign Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in Ccdc87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Ccdc87 APN 19 4841031 missense probably damaging 1.00
IGL02754:Ccdc87 APN 19 4839861 missense probably damaging 1.00
IGL03124:Ccdc87 APN 19 4841054 missense probably damaging 0.99
IGL03151:Ccdc87 APN 19 4841557 missense probably benign 0.01
R1572:Ccdc87 UTSW 19 4840313 missense probably benign 0.03
R2031:Ccdc87 UTSW 19 4841687 missense probably damaging 1.00
R3714:Ccdc87 UTSW 19 4840259 missense probably benign 0.00
R3734:Ccdc87 UTSW 19 4841923 missense probably damaging 1.00
R3854:Ccdc87 UTSW 19 4839518 missense probably benign 0.36
R4820:Ccdc87 UTSW 19 4840551 missense probably damaging 1.00
R5039:Ccdc87 UTSW 19 4840401 splice site probably null
R5634:Ccdc87 UTSW 19 4840665 missense probably benign 0.00
R5659:Ccdc87 UTSW 19 4840850 missense probably damaging 0.99
R6065:Ccdc87 UTSW 19 4841240 missense probably benign
R6237:Ccdc87 UTSW 19 4841379 missense probably benign 0.15
R6337:Ccdc87 UTSW 19 4839801 missense probably benign 0.00
R6349:Ccdc87 UTSW 19 4841319 missense probably damaging 1.00
R6429:Ccdc87 UTSW 19 4841235 missense probably benign 0.06
R6520:Ccdc87 UTSW 19 4841789 missense probably damaging 0.99
R7131:Ccdc87 UTSW 19 4841757 missense probably damaging 1.00
R7237:Ccdc87 UTSW 19 4839762 missense probably benign 0.00
R7349:Ccdc87 UTSW 19 4841840 missense probably damaging 0.98
R7848:Ccdc87 UTSW 19 4841508 missense probably damaging 1.00
R8382:Ccdc87 UTSW 19 4839990 missense possibly damaging 0.88
Z1088:Ccdc87 UTSW 19 4840722 missense probably benign 0.02
Z1176:Ccdc87 UTSW 19 4841923 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAAAGAGGGAGTCGTTGC -3'
(R):5'- TTGGCCGCCTTAGTGAGTAG -3'

Sequencing Primer
(F):5'- AGTCGTTGCTAGGAAGACTGG -3'
(R):5'- TATTCCCGGGGGCCACTAAC -3'
Posted On2015-10-08