Incidental Mutation 'R4643:R3hcc1l'
ID351753
Institutional Source Beutler Lab
Gene Symbol R3hcc1l
Ensembl Gene ENSMUSG00000025184
Gene NameR3H domain and coiled-coil containing 1 like
SynonymsD19Ertd386e, 1700036B12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4643 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location42518759-42592343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42562800 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 79 (V79F)
Ref Sequence ENSEMBL: ENSMUSP00000026188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026188] [ENSMUST00000160107] [ENSMUST00000160893]
Predicted Effect probably benign
Transcript: ENSMUST00000026188
AA Change: V79F

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000026188
Gene: ENSMUSG00000025184
AA Change: V79F

DomainStartEndE-ValueType
low complexity region 163 178 N/A INTRINSIC
low complexity region 694 706 N/A INTRINSIC
coiled coil region 734 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160107
SMART Domains Protein: ENSMUSP00000124036
Gene: ENSMUSG00000025184

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
coiled coil region 154 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160893
AA Change: V79F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162829
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,474,860 N398D probably damaging Het
Adamtsl4 G A 3: 95,684,619 A58V possibly damaging Het
Anapc2 T A 2: 25,276,394 V105E probably benign Het
C3ar1 A T 6: 122,850,974 C95S probably damaging Het
Ccdc87 G A 19: 4,841,849 G790R probably damaging Het
Cenpf A T 1: 189,659,589 M682K probably benign Het
Cyp2j13 T C 4: 96,056,924 Q289R possibly damaging Het
Dclk2 A T 3: 86,806,180 M453K possibly damaging Het
Dscam G A 16: 96,685,301 T1058M probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Grip1 A G 10: 120,020,101 N659S probably damaging Het
Hectd4 A G 5: 121,349,055 K3371R possibly damaging Het
Il1a T A 2: 129,304,703 T157S probably benign Het
Il23r A G 6: 67,423,993 V451A probably benign Het
Iqch T C 9: 63,594,802 T40A probably benign Het
Kazald1 G T 19: 45,078,349 V196L probably benign Het
L1td1 T C 4: 98,737,883 S772P probably damaging Het
Lgi1 A T 19: 38,300,710 D145V probably damaging Het
Lrmp A T 6: 145,168,060 D318V probably benign Het
Lrp12 A T 15: 39,872,022 L838Q probably damaging Het
Mrgprf C A 7: 145,308,505 P268Q probably benign Het
Myef2 T C 2: 125,116,811 K66R possibly damaging Het
Myo3b A G 2: 70,238,842 D475G possibly damaging Het
Numa1 C G 7: 102,000,665 probably null Het
Olfr807 T C 10: 129,754,955 E165G probably damaging Het
Prdm8 T C 5: 98,184,587 S116P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rasal1 C T 5: 120,678,964 T779I probably benign Het
Scaper A C 9: 55,838,179 F596V probably damaging Het
Slco2b1 C T 7: 99,667,007 V439M probably benign Het
Slco6c1 A T 1: 97,062,424 D680E probably benign Het
Smurf1 A T 5: 144,879,369 F725L probably damaging Het
Snd1 A G 6: 28,880,249 E674G probably benign Het
Srcap C T 7: 127,541,776 P1515L probably damaging Het
Sycp2l A G 13: 41,143,465 M341V probably benign Het
Tmprss6 T A 15: 78,445,356 I492F probably damaging Het
Trip10 G T 17: 57,261,658 E416* probably null Het
Tstd2 T C 4: 46,129,297 D177G possibly damaging Het
Ugt1a5 A T 1: 88,166,425 N125I possibly damaging Het
Vmn2r7 G T 3: 64,716,404 S165Y probably damaging Het
Zfp663 A T 2: 165,353,005 H431Q probably benign Het
Other mutations in R3hcc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:R3hcc1l APN 19 42563952 missense probably benign 0.04
IGL01731:R3hcc1l APN 19 42562801 missense probably benign 0.01
IGL01921:R3hcc1l APN 19 42563781 missense possibly damaging 0.87
IGL01933:R3hcc1l APN 19 42562950 missense probably damaging 0.99
IGL02047:R3hcc1l APN 19 42563819 missense probably benign 0.20
IGL02658:R3hcc1l APN 19 42562702 missense probably damaging 0.99
IGL02952:R3hcc1l APN 19 42563994 missense probably damaging 0.97
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0233:R3hcc1l UTSW 19 42582921 critical splice donor site probably null
R0254:R3hcc1l UTSW 19 42563148 missense probably damaging 1.00
R0285:R3hcc1l UTSW 19 42576129 missense probably damaging 1.00
R0483:R3hcc1l UTSW 19 42562556 utr 5 prime probably benign
R0727:R3hcc1l UTSW 19 42576075 missense probably damaging 1.00
R1052:R3hcc1l UTSW 19 42563654 missense probably damaging 0.99
R1061:R3hcc1l UTSW 19 42583426 nonsense probably null
R1570:R3hcc1l UTSW 19 42581954 missense probably damaging 1.00
R1641:R3hcc1l UTSW 19 42563607 missense possibly damaging 0.87
R2378:R3hcc1l UTSW 19 42563473 missense probably damaging 0.99
R2696:R3hcc1l UTSW 19 42563988 missense possibly damaging 0.94
R3051:R3hcc1l UTSW 19 42562625 nonsense probably null
R3053:R3hcc1l UTSW 19 42562625 nonsense probably null
R4471:R3hcc1l UTSW 19 42582820 splice site probably benign
R4772:R3hcc1l UTSW 19 42583557 splice site probably benign
R5524:R3hcc1l UTSW 19 42563868 nonsense probably null
R5976:R3hcc1l UTSW 19 42563350 missense probably benign 0.06
R6965:R3hcc1l UTSW 19 42562845 missense probably damaging 1.00
R7086:R3hcc1l UTSW 19 42581970 missense probably damaging 0.99
R7158:R3hcc1l UTSW 19 42583429 missense probably damaging 1.00
R7317:R3hcc1l UTSW 19 42583540 nonsense probably null
R7447:R3hcc1l UTSW 19 42562662 missense probably benign 0.02
R7792:R3hcc1l UTSW 19 42563964 missense probably damaging 0.96
R8222:R3hcc1l UTSW 19 42576177 missense probably damaging 1.00
X0064:R3hcc1l UTSW 19 42583545 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTACCTAAAGCTCGAAGGGG -3'
(R):5'- CAGTCTGAACTTCCCAACAGTC -3'

Sequencing Primer
(F):5'- GGGAACAGCTCTCCTCAAGTC -3'
(R):5'- TGAACTTCCCAACAGTCCATGTC -3'
Posted On2015-10-08