Incidental Mutation 'R4644:Ptpra'
ID351766
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
MMRRC Submission 041905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4644 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130544158 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 595 (I595T)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
PDB Structure
Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: I559T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: I559T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077303
AA Change: I595T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: I595T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230886
Predicted Effect probably benign
Transcript: ENSMUST00000230981
Meta Mutation Damage Score 0.5543 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A G 10: 22,066,761 V440A probably benign Het
Adcy10 T G 1: 165,551,361 probably null Het
Ano5 C A 7: 51,587,685 Y702* probably null Het
Bsph2 A T 7: 13,571,017 V11E possibly damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cflar T A 1: 58,731,267 I173N probably damaging Het
Dgkd T C 1: 87,936,294 V904A probably damaging Het
Diexf A G 1: 193,128,480 Y72H probably damaging Het
Dnajc21 T C 15: 10,463,917 D54G possibly damaging Het
Doc2a C A 7: 126,851,446 T298K probably benign Het
Dsg1a A T 18: 20,340,728 I953L probably benign Het
Fga C A 3: 83,030,266 A150E possibly damaging Het
Frem3 T A 8: 80,613,727 M883K probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Klhdc4 G C 8: 121,822,000 probably benign Het
Mgst1 T C 6: 138,156,370 Y50H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nsmaf A G 4: 6,419,940 probably benign Het
Pp2d1 T C 17: 53,515,987 K17R probably benign Het
Prss39 C T 1: 34,502,126 T237M probably damaging Het
Ptpre C T 7: 135,651,932 probably benign Het
Rictor C A 15: 6,777,935 C728* probably null Het
Scn11a C T 9: 119,815,203 probably null Het
Scn1b A T 7: 31,117,787 L170* probably null Het
Slc35f3 A G 8: 126,321,070 R50G possibly damaging Het
Sorcs3 G A 19: 48,683,597 V412M probably damaging Het
Spg11 C T 2: 122,061,029 V1954I probably benign Het
Srcap C T 7: 127,552,598 R2049C probably damaging Het
Ssh2 T C 11: 77,449,576 V518A possibly damaging Het
Stab1 G A 14: 31,140,487 probably benign Het
Tenm2 A G 11: 36,047,136 F1570S probably benign Het
Tpr T A 1: 150,423,499 V1076E probably benign Het
Ttn A T 2: 76,732,413 Y26986* probably null Het
Unc45a C T 7: 80,328,509 A673T probably damaging Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
R8044:Ptpra UTSW 2 130544961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CATTTGGAAATGGAGCCGAGC -3'
(R):5'- AAGACAGCAATGTTCCTTTGGC -3'

Sequencing Primer
(F):5'- TGGAGCCGAGCACTGTAG -3'
(R):5'- ACAGCAATGTTCCTTTGGCTTTTG -3'
Posted On2015-10-08