Mutagenetix > Incidental Mutation

Incidental Mutation 'R4644:Fga'

351768

Institutional Source

Beutler Lab

Gene Symbol

Fga

Ensembl Gene

ENSMUSG00000028001

Gene Name

fibrinogen alpha chain

Synonyms

ENSMUSG00000059807, Fib

MMRRC Submission

041905-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R4644 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83026076-83033627 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 83030266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 150 (A150E)

Ref Sequence

ENSEMBL: ENSMUSP00000133117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]

AlphaFold

E9PV24

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029630
AA Change: A150E

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: A150E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	458	1.6e-33	PFAM
low complexity region	500	522	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166581
AA Change: A150E

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: A150E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
Fib_alpha	49	193	1.29e-69	SMART
low complexity region	264	286	N/A	INTRINSIC
low complexity region	311	340	N/A	INTRINSIC
Pfam:Fibrinogen_aC	392	457	9.3e-34	PFAM
low complexity region	500	522	N/A	INTRINSIC
FBG	550	786	1.43e-128	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444G20Rik	A	G	10: 22,066,761	V440A	probably benign	Het
Adcy10	T	G	1: 165,551,361		probably null	Het
Ano5	C	A	7: 51,587,685	Y702*	probably null	Het
Bsph2	A	T	7: 13,571,017	V11E	possibly damaging	Het
Camk1g	T	A	1: 193,356,359	D85V	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Cflar	T	A	1: 58,731,267	I173N	probably damaging	Het
Dgkd	T	C	1: 87,936,294	V904A	probably damaging	Het
Diexf	A	G	1: 193,128,480	Y72H	probably damaging	Het
Dnajc21	T	C	15: 10,463,917	D54G	possibly damaging	Het
Doc2a	C	A	7: 126,851,446	T298K	probably benign	Het
Dsg1a	A	T	18: 20,340,728	I953L	probably benign	Het
Frem3	T	A	8: 80,613,727	M883K	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Klhdc4	G	C	8: 121,822,000		probably benign	Het
Mgst1	T	C	6: 138,156,370	Y50H	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nsmaf	A	G	4: 6,419,940		probably benign	Het
Pp2d1	T	C	17: 53,515,987	K17R	probably benign	Het
Prss39	C	T	1: 34,502,126	T237M	probably damaging	Het
Ptpra	T	C	2: 130,544,158	I595T	probably damaging	Het
Ptpre	C	T	7: 135,651,932		probably benign	Het
Rictor	C	A	15: 6,777,935	C728*	probably null	Het
Scn11a	C	T	9: 119,815,203		probably null	Het
Scn1b	A	T	7: 31,117,787	L170*	probably null	Het
Slc35f3	A	G	8: 126,321,070	R50G	possibly damaging	Het
Sorcs3	G	A	19: 48,683,597	V412M	probably damaging	Het
Spg11	C	T	2: 122,061,029	V1954I	probably benign	Het
Srcap	C	T	7: 127,552,598	R2049C	probably damaging	Het
Ssh2	T	C	11: 77,449,576	V518A	possibly damaging	Het
Stab1	G	A	14: 31,140,487		probably benign	Het
Tenm2	A	G	11: 36,047,136	F1570S	probably benign	Het
Tpr	T	A	1: 150,423,499	V1076E	probably benign	Het
Ttn	A	T	2: 76,732,413	Y26986*	probably null	Het
Unc45a	C	T	7: 80,328,509	A673T	probably damaging	Het

Other mutations in Fga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Fga	APN	3	83031674	missense	probably damaging	1.00
IGL00478:Fga	APN	3	83028644	missense	probably benign	0.00
IGL00587:Fga	APN	3	83030289	missense	possibly damaging	0.62
IGL01289:Fga	APN	3	83031245	missense	possibly damaging	0.85
IGL01323:Fga	APN	3	83030211	missense	probably damaging	0.99
IGL01369:Fga	APN	3	83030200	missense	probably benign	0.00
IGL01409:Fga	APN	3	83032752	missense	probably damaging	1.00
IGL01541:Fga	APN	3	83032707	missense	probably damaging	1.00
IGL01633:Fga	APN	3	83030299	missense	possibly damaging	0.89
IGL01966:Fga	APN	3	83029154	missense	probably damaging	0.97
IGL02651:Fga	APN	3	83028534	missense	probably benign	0.00
IGL02822:Fga	APN	3	83031482	missense	probably damaging	1.00
IGL03003:Fga	APN	3	83032730	missense	probably damaging	1.00
R0336:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R0540:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R0607:Fga	UTSW	3	83028562	missense	probably damaging	1.00
R1471:Fga	UTSW	3	83028618	missense	probably benign	0.16
R1517:Fga	UTSW	3	83031838	missense	probably benign	0.00
R1817:Fga	UTSW	3	83031775	missense	probably benign	0.00
R1874:Fga	UTSW	3	83032721	missense	probably damaging	1.00
R2014:Fga	UTSW	3	83032757	missense	probably damaging	0.99
R2267:Fga	UTSW	3	83032950	missense	probably damaging	1.00
R2332:Fga	UTSW	3	83031397	missense	probably damaging	1.00
R2420:Fga	UTSW	3	83033154	missense	possibly damaging	0.53
R2443:Fga	UTSW	3	83028541	missense	probably benign	0.03
R3978:Fga	UTSW	3	83030183	critical splice acceptor site	probably null
R4597:Fga	UTSW	3	83031235	nonsense	probably null
R4760:Fga	UTSW	3	83031514	missense	probably benign
R4867:Fga	UTSW	3	83028644	missense	probably benign	0.00
R5449:Fga	UTSW	3	83030862	frame shift	probably null
R5507:Fga	UTSW	3	83033336	missense	probably damaging	1.00
R5712:Fga	UTSW	3	83033133	missense	possibly damaging	0.70
R6853:Fga	UTSW	3	83030912	missense	probably damaging	1.00
R6865:Fga	UTSW	3	83031541	missense	probably damaging	1.00
R7163:Fga	UTSW	3	83026264	missense	probably benign	0.04
R7724:Fga	UTSW	3	83029125	missense	probably damaging	0.99
R8153:Fga	UTSW	3	83030857	missense	probably damaging	1.00
R8506:Fga	UTSW	3	83033316	missense	probably damaging	1.00
R8511:Fga	UTSW	3	83031757	nonsense	probably null
R8523:Fga	UTSW	3	83030851	missense	probably damaging	1.00
R8801:Fga	UTSW	3	83030881	missense	possibly damaging	0.89
R8906:Fga	UTSW	3	83031804	missense	probably benign	0.12
R9390:Fga	UTSW	3	83033303	missense	probably damaging	1.00
R9609:Fga	UTSW	3	83032757	missense	probably damaging	1.00
X0062:Fga	UTSW	3	83030271	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGGATGACTCTCCTGTGGAAC -3'
(R):5'- GGGTGAGACACTTCTATTCTGAATG -3'

Sequencing Primer
(F):5'- GATGACTCTCCTGTGGAACAATCTG -3'
(R):5'- AGGCAGCTAGTGTCTTCT -3'

Posted On

2015-10-08