Incidental Mutation 'R4644:Fga'
ID351768
Institutional Source Beutler Lab
Gene Symbol Fga
Ensembl Gene ENSMUSG00000028001
Gene Namefibrinogen alpha chain
SynonymsENSMUSG00000059807, Fib
MMRRC Submission 041905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4644 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83026076-83033627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83030266 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 150 (A150E)
Ref Sequence ENSEMBL: ENSMUSP00000133117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029630] [ENSMUST00000166581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029630
AA Change: A150E

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029630
Gene: ENSMUSG00000028001
AA Change: A150E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 458 1.6e-33 PFAM
low complexity region 500 522 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166581
AA Change: A150E

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133117
Gene: ENSMUSG00000028001
AA Change: A150E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
Fib_alpha 49 193 1.29e-69 SMART
low complexity region 264 286 N/A INTRINSIC
low complexity region 311 340 N/A INTRINSIC
Pfam:Fibrinogen_aC 392 457 9.3e-34 PFAM
low complexity region 500 522 N/A INTRINSIC
FBG 550 786 1.43e-128 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded protein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mice lacking the encoded protein display bleeding in the peritoneal cavity, skin and soft tissues around joints immediately after birth, and are predisposed to spontaneous fatal abdominal hemorrhage as they grow. Pregnant mice lacking the encoded protein succumb to uterine bleeding during gestation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions of this gene have blood that is unable to clot. On some genetic backgrounds this can lead to fatal hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A G 10: 22,066,761 V440A probably benign Het
Adcy10 T G 1: 165,551,361 probably null Het
Ano5 C A 7: 51,587,685 Y702* probably null Het
Bsph2 A T 7: 13,571,017 V11E possibly damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cflar T A 1: 58,731,267 I173N probably damaging Het
Dgkd T C 1: 87,936,294 V904A probably damaging Het
Diexf A G 1: 193,128,480 Y72H probably damaging Het
Dnajc21 T C 15: 10,463,917 D54G possibly damaging Het
Doc2a C A 7: 126,851,446 T298K probably benign Het
Dsg1a A T 18: 20,340,728 I953L probably benign Het
Frem3 T A 8: 80,613,727 M883K probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Klhdc4 G C 8: 121,822,000 probably benign Het
Mgst1 T C 6: 138,156,370 Y50H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nsmaf A G 4: 6,419,940 probably benign Het
Pp2d1 T C 17: 53,515,987 K17R probably benign Het
Prss39 C T 1: 34,502,126 T237M probably damaging Het
Ptpra T C 2: 130,544,158 I595T probably damaging Het
Ptpre C T 7: 135,651,932 probably benign Het
Rictor C A 15: 6,777,935 C728* probably null Het
Scn11a C T 9: 119,815,203 probably null Het
Scn1b A T 7: 31,117,787 L170* probably null Het
Slc35f3 A G 8: 126,321,070 R50G possibly damaging Het
Sorcs3 G A 19: 48,683,597 V412M probably damaging Het
Spg11 C T 2: 122,061,029 V1954I probably benign Het
Srcap C T 7: 127,552,598 R2049C probably damaging Het
Ssh2 T C 11: 77,449,576 V518A possibly damaging Het
Stab1 G A 14: 31,140,487 probably benign Het
Tenm2 A G 11: 36,047,136 F1570S probably benign Het
Tpr T A 1: 150,423,499 V1076E probably benign Het
Ttn A T 2: 76,732,413 Y26986* probably null Het
Unc45a C T 7: 80,328,509 A673T probably damaging Het
Other mutations in Fga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Fga APN 3 83031674 missense probably damaging 1.00
IGL00478:Fga APN 3 83028644 missense probably benign 0.00
IGL00587:Fga APN 3 83030289 missense possibly damaging 0.62
IGL01289:Fga APN 3 83031245 missense possibly damaging 0.85
IGL01323:Fga APN 3 83030211 missense probably damaging 0.99
IGL01369:Fga APN 3 83030200 missense probably benign 0.00
IGL01409:Fga APN 3 83032752 missense probably damaging 1.00
IGL01541:Fga APN 3 83032707 missense probably damaging 1.00
IGL01633:Fga APN 3 83030299 missense possibly damaging 0.89
IGL01966:Fga APN 3 83029154 missense probably damaging 0.97
IGL02651:Fga APN 3 83028534 missense probably benign 0.00
IGL02822:Fga APN 3 83031482 missense probably damaging 1.00
IGL03003:Fga APN 3 83032730 missense probably damaging 1.00
R0336:Fga UTSW 3 83030857 missense probably damaging 1.00
R0540:Fga UTSW 3 83028562 missense probably damaging 1.00
R0607:Fga UTSW 3 83028562 missense probably damaging 1.00
R1471:Fga UTSW 3 83028618 missense probably benign 0.16
R1517:Fga UTSW 3 83031838 missense probably benign 0.00
R1817:Fga UTSW 3 83031775 missense probably benign 0.00
R1874:Fga UTSW 3 83032721 missense probably damaging 1.00
R2014:Fga UTSW 3 83032757 missense probably damaging 0.99
R2267:Fga UTSW 3 83032950 missense probably damaging 1.00
R2332:Fga UTSW 3 83031397 missense probably damaging 1.00
R2420:Fga UTSW 3 83033154 missense possibly damaging 0.53
R2443:Fga UTSW 3 83028541 missense probably benign 0.03
R3978:Fga UTSW 3 83030183 critical splice acceptor site probably null
R4597:Fga UTSW 3 83031235 nonsense probably null
R4760:Fga UTSW 3 83031514 missense probably benign
R4867:Fga UTSW 3 83028644 missense probably benign 0.00
R5449:Fga UTSW 3 83030862 frame shift probably null
R5507:Fga UTSW 3 83033336 missense probably damaging 1.00
R5712:Fga UTSW 3 83033133 missense possibly damaging 0.70
R6853:Fga UTSW 3 83030912 missense probably damaging 1.00
R6865:Fga UTSW 3 83031541 missense probably damaging 1.00
R7163:Fga UTSW 3 83026264 missense probably benign 0.04
R7724:Fga UTSW 3 83029125 missense probably damaging 0.99
X0062:Fga UTSW 3 83030271 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TGGATGACTCTCCTGTGGAAC -3'
(R):5'- GGGTGAGACACTTCTATTCTGAATG -3'

Sequencing Primer
(F):5'- GATGACTCTCCTGTGGAACAATCTG -3'
(R):5'- AGGCAGCTAGTGTCTTCT -3'
Posted On2015-10-08