Incidental Mutation 'R4644:Unc45a'
ID351774
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 041905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4644 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80328509 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 673 (A673T)
Ref Sequence ENSEMBL: ENSMUSP00000102991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000047362] [ENSMUST00000107368] [ENSMUST00000121882] [ENSMUST00000123189] [ENSMUST00000154428]
Predicted Effect probably damaging
Transcript: ENSMUST00000032748
AA Change: A673T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: A673T

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047362
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107368
AA Change: A673T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: A673T

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121882
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect probably benign
Transcript: ENSMUST00000123189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect probably benign
Transcript: ENSMUST00000154428
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205863
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Meta Mutation Damage Score 0.2126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A G 10: 22,066,761 V440A probably benign Het
Adcy10 T G 1: 165,551,361 probably null Het
Ano5 C A 7: 51,587,685 Y702* probably null Het
Bsph2 A T 7: 13,571,017 V11E possibly damaging Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cflar T A 1: 58,731,267 I173N probably damaging Het
Dgkd T C 1: 87,936,294 V904A probably damaging Het
Diexf A G 1: 193,128,480 Y72H probably damaging Het
Dnajc21 T C 15: 10,463,917 D54G possibly damaging Het
Doc2a C A 7: 126,851,446 T298K probably benign Het
Dsg1a A T 18: 20,340,728 I953L probably benign Het
Fga C A 3: 83,030,266 A150E possibly damaging Het
Frem3 T A 8: 80,613,727 M883K probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Klhdc4 G C 8: 121,822,000 probably benign Het
Mgst1 T C 6: 138,156,370 Y50H probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nsmaf A G 4: 6,419,940 probably benign Het
Pp2d1 T C 17: 53,515,987 K17R probably benign Het
Prss39 C T 1: 34,502,126 T237M probably damaging Het
Ptpra T C 2: 130,544,158 I595T probably damaging Het
Ptpre C T 7: 135,651,932 probably benign Het
Rictor C A 15: 6,777,935 C728* probably null Het
Scn11a C T 9: 119,815,203 probably null Het
Scn1b A T 7: 31,117,787 L170* probably null Het
Slc35f3 A G 8: 126,321,070 R50G possibly damaging Het
Sorcs3 G A 19: 48,683,597 V412M probably damaging Het
Spg11 C T 2: 122,061,029 V1954I probably benign Het
Srcap C T 7: 127,552,598 R2049C probably damaging Het
Ssh2 T C 11: 77,449,576 V518A possibly damaging Het
Stab1 G A 14: 31,140,487 probably benign Het
Tenm2 A G 11: 36,047,136 F1570S probably benign Het
Tpr T A 1: 150,423,499 V1076E probably benign Het
Ttn A T 2: 76,732,413 Y26986* probably null Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGAGCCTGTCCACAGAAGTATC -3'
(R):5'- TGCTGACGAACTCCTGTAGG -3'

Sequencing Primer
(F):5'- GTATCACACTCCACTGGCAAAAGTTC -3'
(R):5'- AGCTACTCTCCAGGTGAGC -3'
Posted On2015-10-08