Incidental Mutation 'R4665:Olfr1122'
Institutional Source Beutler Lab
Gene Symbol Olfr1122
Ensembl Gene ENSMUSG00000047594
Gene Nameolfactory receptor 1122
SynonymsGA_x6K02T2Q125-48880078-48881058, MOR264-1
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosomal Location87385849-87391930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87387876 bp
Amino Acid Change Isoleucine to Lysine at position 57 (I57K)
Ref Sequence ENSEMBL: ENSMUSP00000149403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056435] [ENSMUST00000215371]
Predicted Effect probably damaging
Transcript: ENSMUST00000056435
AA Change: I57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052190
Gene: ENSMUSG00000047594
AA Change: I57K

Pfam:7tm_4 43 319 6.3e-51 PFAM
Pfam:7tm_1 53 302 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215371
AA Change: I57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atm A G 9: 53,464,229 W2097R probably benign Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Cux1 G A 5: 136,286,799 T1129I probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gmps T C 3: 64,001,535 V486A probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tdrd6 T A 17: 43,624,116 M2014L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Olfr1122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1122 APN 2 87387843 missense possibly damaging 0.91
IGL01783:Olfr1122 APN 2 87387838 missense probably benign 0.39
IGL02396:Olfr1122 APN 2 87387705 utr 5 prime probably benign
IGL03338:Olfr1122 APN 2 87388126 missense probably benign 0.05
IGL03373:Olfr1122 APN 2 87388233 missense probably damaging 1.00
R0594:Olfr1122 UTSW 2 87387954 missense probably damaging 1.00
R1245:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1471:Olfr1122 UTSW 2 87388518 missense probably damaging 1.00
R1681:Olfr1122 UTSW 2 87388620 missense possibly damaging 0.95
R1995:Olfr1122 UTSW 2 87387831 missense probably damaging 0.97
R2246:Olfr1122 UTSW 2 87387851 missense probably benign 0.00
R2341:Olfr1122 UTSW 2 87387740 missense probably benign
R4008:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4009:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4011:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4119:Olfr1122 UTSW 2 87387843 missense possibly damaging 0.91
R4547:Olfr1122 UTSW 2 87388160 missense probably benign 0.07
R4666:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4801:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R4802:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R5049:Olfr1122 UTSW 2 87388658 missense probably benign 0.00
R5070:Olfr1122 UTSW 2 87388163 missense probably damaging 1.00
R7594:Olfr1122 UTSW 2 87388269 missense probably damaging 1.00
R7684:Olfr1122 UTSW 2 87388028 missense probably damaging 0.99
R8064:Olfr1122 UTSW 2 87388509 missense probably benign 0.00
R8218:Olfr1122 UTSW 2 87388578 missense probably damaging 0.99
R8282:Olfr1122 UTSW 2 87388508 missense probably benign 0.01
R8335:Olfr1122 UTSW 2 87387860 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08