Incidental Mutation 'R4665:Gmps'
ID351808
Institutional Source Beutler Lab
Gene Symbol Gmps
Ensembl Gene ENSMUSG00000027823
Gene Nameguanine monophosphate synthetase
SynonymsGm9479
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location63976106-64022579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64001535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 486 (V486A)
Ref Sequence ENSEMBL: ENSMUSP00000029405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029405]
Predicted Effect probably benign
Transcript: ENSMUST00000029405
AA Change: V486A

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029405
Gene: ENSMUSG00000027823
AA Change: V486A

DomainStartEndE-ValueType
Pfam:GATase 29 210 6.3e-42 PFAM
Pfam:Peptidase_C26 91 192 1.9e-14 PFAM
Pfam:NAD_synthase 219 339 2.8e-10 PFAM
Pfam:Asn_synthase 231 315 3.9e-6 PFAM
Pfam:tRNA_Me_trans 237 318 1.1e-6 PFAM
Pfam:QueC 238 353 5.3e-9 PFAM
Pfam:GMP_synt_C 492 692 1.4e-32 PFAM
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In the de novo synthesis of purine nucleotides, IMP is the branch point metabolite at which point the pathway diverges to the synthesis of either guanine or adenine nucleotides. In the guanine nucleotide pathway, there are 2 enzymes involved in converting IMP to GMP, namely IMP dehydrogenase (IMPD1), which catalyzes the oxidation of IMP to XMP, and GMP synthetase, which catalyzes the amination of XMP to GMP. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atm A G 9: 53,464,229 W2097R probably benign Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Cux1 G A 5: 136,286,799 T1129I probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tdrd6 T A 17: 43,624,116 M2014L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Gmps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Gmps APN 3 64014367 missense probably benign
IGL01341:Gmps APN 3 64015440 missense probably damaging 1.00
IGL01369:Gmps APN 3 64001592 missense probably benign 0.00
IGL02332:Gmps APN 3 63990569 missense probably benign 0.01
IGL02481:Gmps APN 3 64014352 missense probably damaging 1.00
IGL02483:Gmps APN 3 64014352 missense probably damaging 1.00
IGL03173:Gmps APN 3 63990329 missense probably damaging 0.98
K3955:Gmps UTSW 3 64001533 missense probably damaging 1.00
R0089:Gmps UTSW 3 63998698 missense probably benign 0.20
R0165:Gmps UTSW 3 63993954 missense probably damaging 1.00
R0466:Gmps UTSW 3 63993944 missense probably damaging 0.97
R0940:Gmps UTSW 3 63976322 splice site probably benign
R1686:Gmps UTSW 3 63985654 missense probably damaging 1.00
R1872:Gmps UTSW 3 64001517 missense probably benign 0.15
R1924:Gmps UTSW 3 63998628 missense probably damaging 1.00
R2229:Gmps UTSW 3 64014263 nonsense probably null
R3014:Gmps UTSW 3 64015436 missense possibly damaging 0.79
R3800:Gmps UTSW 3 63982445 missense possibly damaging 0.48
R4118:Gmps UTSW 3 63980194 missense probably benign 0.00
R4293:Gmps UTSW 3 63990619 missense probably damaging 0.99
R4596:Gmps UTSW 3 63993917 nonsense probably null
R5032:Gmps UTSW 3 63990325 missense probably benign 0.01
R6045:Gmps UTSW 3 63980137 missense probably benign
R6153:Gmps UTSW 3 64001543 missense probably benign 0.00
R6985:Gmps UTSW 3 64015539 missense probably damaging 1.00
R7188:Gmps UTSW 3 64011561 missense probably damaging 0.97
R7523:Gmps UTSW 3 64011666 missense possibly damaging 0.78
R7724:Gmps UTSW 3 63985653 missense possibly damaging 0.85
R7819:Gmps UTSW 3 63985627 missense probably damaging 1.00
R7849:Gmps UTSW 3 64015563 missense probably benign 0.33
R7932:Gmps UTSW 3 64015563 missense probably benign 0.33
X0063:Gmps UTSW 3 63996850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTTGGGAGAATCACCAGTTC -3'
(R):5'- TCTGAAAGTTTTCCTGTGACTAGAG -3'

Sequencing Primer
(F):5'- TTGGGAGAATCACCAGTTCAAAATAG -3'
(R):5'- GTTTTCCTGTGACTAGAGATACAAC -3'
Posted On2015-10-08