Incidental Mutation 'R4665:Cux1'
ID351825
Institutional Source Beutler Lab
Gene Symbol Cux1
Ensembl Gene ENSMUSG00000029705
Gene Namecut-like homeobox 1
SynonymsCux-1, Cutl1, CDP, Cux
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136248135-136567490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136286799 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1129 (T1129I)
Ref Sequence ENSEMBL: ENSMUSP00000135086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000175998] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]
Predicted Effect probably damaging
Transcript: ENSMUST00000004097
AA Change: T1038I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705
AA Change: T1038I

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
CUT 452 538 5.06e-39 SMART
low complexity region 602 608 N/A INTRINSIC
low complexity region 620 642 N/A INTRINSIC
CUT 841 929 3.31e-43 SMART
low complexity region 956 972 N/A INTRINSIC
low complexity region 990 1011 N/A INTRINSIC
CUT 1024 1110 3.78e-38 SMART
HOX 1150 1212 6.32e-15 SMART
low complexity region 1224 1239 N/A INTRINSIC
low complexity region 1317 1379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163906
SMART Domains Protein: ENSMUSP00000131685
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
CUT 58 144 2.9e-42 SMART
HOX 184 246 3.3e-17 SMART
low complexity region 258 273 N/A INTRINSIC
low complexity region 351 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175918
SMART Domains Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 73 328 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175975
AA Change: T1116I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705
AA Change: T1116I

DomainStartEndE-ValueType
coiled coil region 1 169 N/A INTRINSIC
low complexity region 235 251 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 331 342 N/A INTRINSIC
CUT 358 444 5.06e-39 SMART
low complexity region 508 514 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
CUT 747 835 3.31e-43 SMART
low complexity region 862 878 N/A INTRINSIC
low complexity region 896 917 N/A INTRINSIC
CUT 930 1016 3.78e-38 SMART
HOX 1056 1118 6.32e-15 SMART
low complexity region 1130 1145 N/A INTRINSIC
low complexity region 1223 1285 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175998
SMART Domains Protein: ENSMUSP00000135816
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
coiled coil region 76 148 N/A INTRINSIC
Pfam:CASP_C 204 430 8.6e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176172
AA Change: T1129I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705
AA Change: T1129I

DomainStartEndE-ValueType
coiled coil region 99 354 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
low complexity region 462 474 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
CUT 543 629 5.06e-39 SMART
low complexity region 693 699 N/A INTRINSIC
low complexity region 711 733 N/A INTRINSIC
CUT 932 1020 3.31e-43 SMART
low complexity region 1047 1063 N/A INTRINSIC
low complexity region 1081 1102 N/A INTRINSIC
CUT 1115 1201 3.78e-38 SMART
HOX 1241 1303 6.32e-15 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1408 1470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176216
SMART Domains Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 9.35e-5 PROSPERO
Pfam:CASP_C 421 647 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176486
AA Change: T1000I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135370
Gene: ENSMUSG00000029705
AA Change: T1000I

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
low complexity region 429 445 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
low complexity region 525 536 N/A INTRINSIC
CUT 552 638 5.06e-39 SMART
Blast:CUT 641 840 3e-50 BLAST
CUT 919 1007 3.31e-43 SMART
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1068 1089 N/A INTRINSIC
CUT 1102 1188 3.78e-38 SMART
HOX 1228 1290 6.32e-15 SMART
low complexity region 1302 1317 N/A INTRINSIC
low complexity region 1395 1457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176745
SMART Domains Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 363 N/A INTRINSIC
internal_repeat_1 367 388 8.95e-5 PROSPERO
Pfam:CASP_C 419 645 1.2e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176778
AA Change: T1121I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: T1121I

DomainStartEndE-ValueType
low complexity region 78 86 N/A INTRINSIC
coiled coil region 195 448 N/A INTRINSIC
low complexity region 508 519 N/A INTRINSIC
CUT 535 621 5.06e-39 SMART
low complexity region 685 691 N/A INTRINSIC
low complexity region 703 725 N/A INTRINSIC
CUT 924 1012 3.31e-43 SMART
low complexity region 1039 1055 N/A INTRINSIC
low complexity region 1073 1094 N/A INTRINSIC
CUT 1107 1193 3.78e-38 SMART
HOX 1233 1295 6.32e-15 SMART
low complexity region 1307 1322 N/A INTRINSIC
low complexity region 1400 1462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177297
SMART Domains Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

DomainStartEndE-ValueType
coiled coil region 16 45 N/A INTRINSIC
coiled coil region 110 365 N/A INTRINSIC
internal_repeat_1 369 390 8.99e-6 PROSPERO
Pfam:CASP_C 422 527 1.8e-17 PFAM
Meta Mutation Damage Score 0.5291 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atm A G 9: 53,464,229 W2097R probably benign Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gmps T C 3: 64,001,535 V486A probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tdrd6 T A 17: 43,624,116 M2014L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Cux1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Cux1 APN 5 136326796 missense probably damaging 1.00
IGL00966:Cux1 APN 5 136311491 intron probably benign
IGL01129:Cux1 APN 5 136304718 intron probably benign
IGL01885:Cux1 APN 5 136308447 missense possibly damaging 0.90
IGL01947:Cux1 APN 5 136275125 missense probably benign 0.04
IGL02259:Cux1 APN 5 136326833 missense probably damaging 1.00
IGL02666:Cux1 APN 5 136275315 nonsense probably null
IGL02826:Cux1 APN 5 136308003 missense probably damaging 1.00
IGL03014:Cux1 UTSW 5 136565525 intron probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0047:Cux1 UTSW 5 136363253 splice site probably benign
R0057:Cux1 UTSW 5 136256282 missense probably damaging 1.00
R0149:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0295:Cux1 UTSW 5 136313212 missense probably benign 0.04
R0361:Cux1 UTSW 5 136279497 missense probably damaging 1.00
R0533:Cux1 UTSW 5 136307859 missense probably damaging 1.00
R0630:Cux1 UTSW 5 136286835 missense probably damaging 1.00
R0801:Cux1 UTSW 5 136326929 missense probably damaging 0.97
R0884:Cux1 UTSW 5 136307835 missense probably damaging 1.00
R0976:Cux1 UTSW 5 136313290 missense probably damaging 1.00
R1073:Cux1 UTSW 5 136252541 critical splice donor site probably null
R1222:Cux1 UTSW 5 136275149 missense probably benign 0.18
R1518:Cux1 UTSW 5 136308279 missense probably benign 0.29
R1686:Cux1 UTSW 5 136275381 nonsense probably null
R1687:Cux1 UTSW 5 136312669 missense probably damaging 1.00
R1758:Cux1 UTSW 5 136392322 missense probably damaging 1.00
R1797:Cux1 UTSW 5 136275315 missense probably benign 0.22
R1919:Cux1 UTSW 5 136363319 nonsense probably null
R2051:Cux1 UTSW 5 136332658 missense probably damaging 1.00
R2339:Cux1 UTSW 5 136287008 missense probably damaging 1.00
R3438:Cux1 UTSW 5 136311560 missense probably damaging 0.97
R3713:Cux1 UTSW 5 136565543 intron probably benign
R3800:Cux1 UTSW 5 136316033 missense probably damaging 1.00
R3964:Cux1 UTSW 5 136282942 missense probably damaging 1.00
R4135:Cux1 UTSW 5 136307896 missense probably damaging 1.00
R4198:Cux1 UTSW 5 136286848 missense probably damaging 1.00
R4467:Cux1 UTSW 5 136312722 missense probably damaging 1.00
R4498:Cux1 UTSW 5 136312993 missense probably damaging 1.00
R4622:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4623:Cux1 UTSW 5 136308300 missense probably damaging 0.99
R4651:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4652:Cux1 UTSW 5 136567229 missense probably damaging 1.00
R4658:Cux1 UTSW 5 136250594 missense possibly damaging 0.80
R4704:Cux1 UTSW 5 136249201 missense probably benign 0.01
R4867:Cux1 UTSW 5 136274961 intron probably benign
R4965:Cux1 UTSW 5 136311556 missense possibly damaging 0.77
R5090:Cux1 UTSW 5 136313200 missense possibly damaging 0.95
R5155:Cux1 UTSW 5 136565441 intron probably benign
R5226:Cux1 UTSW 5 136370173 missense probably benign 0.01
R5252:Cux1 UTSW 5 136308297 missense probably damaging 0.98
R5266:Cux1 UTSW 5 136312694 missense probably damaging 1.00
R5399:Cux1 UTSW 5 136252604 missense possibly damaging 0.58
R5509:Cux1 UTSW 5 136275317 missense probably benign 0.13
R5609:Cux1 UTSW 5 136392320 missense probably damaging 1.00
R5681:Cux1 UTSW 5 136308184 missense probably damaging 1.00
R5993:Cux1 UTSW 5 136363271 missense probably benign 0.00
R6049:Cux1 UTSW 5 136332710 missense probably damaging 1.00
R6290:Cux1 UTSW 5 136311558 missense probably damaging 0.99
R6310:Cux1 UTSW 5 136275164 missense probably benign 0.10
R6351:Cux1 UTSW 5 136309792 missense probably damaging 1.00
R6531:Cux1 UTSW 5 136275119 missense probably benign 0.03
R6590:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6663:Cux1 UTSW 5 136485847 missense probably damaging 1.00
R6690:Cux1 UTSW 5 136340117 missense probably damaging 0.99
R6777:Cux1 UTSW 5 136565568 intron probably benign
R6786:Cux1 UTSW 5 136567231 missense probably damaging 1.00
R6817:Cux1 UTSW 5 136373173 intron probably null
R6989:Cux1 UTSW 5 136279648 nonsense probably null
R7011:Cux1 UTSW 5 136360033 missense probably damaging 1.00
R7167:Cux1 UTSW 5 136310041 intron probably null
Predicted Primers PCR Primer
(F):5'- TAAGCTGCTCTGCTCTGGTAC -3'
(R):5'- TGTGAAGAGTCTCACCGAGC -3'

Sequencing Primer
(F):5'- GAACTTTGTGAATGACAACTTGTAGC -3'
(R):5'- CTGGTCCAGCAGCCCTGTC -3'
Posted On2015-10-08