Mutagenetix > Incidental Mutations

Incidental Mutation 'R4665:Thsd7a'

351827

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

041923-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4665 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12504013 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 381 (I381F)

Ref Sequence

ENSEMBL: ENSMUSP00000131662 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119443

SMART Domains

Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	14	70	9.98e-5	SMART
TSP1	77	161	3.14e0	SMART
TSP1	166	225	6.62e-1	SMART
Blast:TSP1	226	262	1e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: I381F

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: I381F

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172356
AA Change: I381F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: I381F

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Meta Mutation Damage Score

0.1612

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,925,077	M76K	probably null	Het
Abcc4	A	G	14: 118,529,002	I886T	probably benign	Het
Adam6a	T	C	12: 113,544,372	Y122H	possibly damaging	Het
Adgre1	A	G	17: 57,480,947	T905A	probably benign	Het
Arap2	A	G	5: 62,669,969	F969L	possibly damaging	Het
Arhgef4	G	T	1: 34,806,032	G1439V	possibly damaging	Het
Atm	A	G	9: 53,464,229	W2097R	probably benign	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
AU016765	T	A	17: 64,519,921		noncoding transcript	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdc42bpa	A	G	1: 180,144,565	T527A	probably damaging	Het
Chmp7	A	T	14: 69,720,955	V255D	probably damaging	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Crygn	T	A	5: 24,751,021		probably benign	Het
Csde1	C	T	3: 103,047,072	T386M	probably damaging	Het
Cux1	G	A	5: 136,286,799	T1129I	probably damaging	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dhx16	T	C	17: 35,879,943	V11A	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Eif5b	A	G	1: 38,045,712	E880G	probably damaging	Het
Eml6	A	T	11: 29,819,007	Y67*	probably null	Het
Faim2	C	A	15: 99,524,700		probably null	Het
Faim2	T	G	15: 99,524,701	S72R	probably benign	Het
Fam103a1	C	T	7: 81,768,430	R78W	probably damaging	Het
Fam160a1	A	T	3: 85,730,681	W104R	probably damaging	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Gak	A	G	5: 108,582,960	I860T	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gdf2	A	G	14: 33,945,451	T377A	probably damaging	Het
Gm2431	A	T	7: 142,257,703	C155S	unknown	Het
Gm37596	G	A	3: 93,692,469	H198Y	probably damaging	Het
Gm5814	A	G	17: 47,410,363	M1V	probably null	Het
Gm5901	C	G	7: 105,377,231	Q69E	possibly damaging	Het
Gm9945	A	G	11: 53,480,375		probably benign	Het
Gmps	T	C	3: 64,001,535	V486A	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Hoxa11	T	A	6: 52,243,503	N267Y	probably damaging	Het
Ifngr2	C	A	16: 91,560,038	H153Q	possibly damaging	Het
Ift172	G	T	5: 31,285,254	Q190K	possibly damaging	Het
Iqch	A	G	9: 63,445,571	V899A	probably damaging	Het
Lactb2	T	C	1: 13,647,400	E133G	probably damaging	Het
Lig3	G	A	11: 82,800,250	V110M	probably damaging	Het
Lin54	C	A	5: 100,453,084	Q262H	possibly damaging	Het
Lingo3	G	A	10: 80,835,538	T186I	probably damaging	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Ly86	T	A	13: 37,375,034	F70I	probably damaging	Het
Mospd2	A	T	X: 164,947,333	S301T	probably benign	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Myo15	A	T	11: 60,504,879		probably null	Het
Nme8	C	G	13: 19,674,435	A78P	probably damaging	Het
Obscn	C	T	11: 59,124,752	V965M	probably damaging	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Parn	T	C	16: 13,541,103	K592E	probably benign	Het
Pax6	C	A	2: 105,683,998		probably benign	Het
Pdcd6	A	T	13: 74,317,206	M1K	probably null	Het
Pex11b	T	C	3: 96,643,835	L198P	possibly damaging	Het
Phldb3	C	T	7: 24,611,427	A28V	probably benign	Het
Pkn3	C	A	2: 30,085,457		probably benign	Het
Pknox1	T	C	17: 31,595,326		probably null	Het
Ptprg	A	C	14: 12,215,288	I1092L	possibly damaging	Het
Pxylp1	A	C	9: 96,825,285	I281M	probably damaging	Het
Retreg2	G	T	1: 75,144,666	L195F	probably damaging	Het
Rgs20	G	C	1: 5,021,008	F66L	probably benign	Het
Ripk4	C	T	16: 97,755,073	V157I	probably damaging	Het
Ryr2	T	C	13: 11,750,685		probably null	Het
Scaper	A	T	9: 55,912,055	S125R	probably damaging	Het
Sec16a	C	T	2: 26,412,958		probably benign	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a12	T	A	6: 121,359,013		probably benign	Het
Slc9a5	A	G	8: 105,368,128	K784E	probably damaging	Het
Snd1	T	C	6: 28,707,054	V455A	probably damaging	Het
Ssbp2	A	T	13: 91,539,335	I46L	possibly damaging	Het
Stil	A	G	4: 115,041,644	D1157G	probably benign	Het
Tax1bp1	T	A	6: 52,737,131	C271S	probably benign	Het
Tdrd6	T	A	17: 43,624,116	M2014L	probably benign	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Tpr	C	T	1: 150,444,399	R2233W	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vgll1	A	G	X: 57,092,432	R54G	possibly damaging	Het
Wdr72	A	G	9: 74,210,024	T673A	probably benign	Het
Zfp169	C	T	13: 48,490,863		probably benign	Het
Zfp319	G	A	8: 95,325,573		probably benign	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12555702	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense

Predicted Primers

PCR Primer
(F):5'- ATTTGGCCTGCAGCTGTTAAAC -3'
(R):5'- CTAATGGCCTGAGAGACTAAAGTG -3'

Sequencing Primer
(F):5'- CTTTCATTCTGTAAAGGAAGCATGG -3'
(R):5'- GTGAAATATCAATGCTTCCTTACAGC -3'

Posted On

2015-10-08