Incidental Mutation 'R4665:Atm'
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53464229 bp
Amino Acid Change Tryptophan to Arginine at position 2097 (W2097R)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: W2097R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: W2097R

TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: W2097R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0660 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Cux1 G A 5: 136,286,799 T1129I probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gmps T C 3: 64,001,535 V486A probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Tdrd6 T A 17: 43,624,116 M2014L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 splice site probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
bull_run UTSW 9 53487922 missense probably benign 0.09
Civil UTSW 9 53492268 missense possibly damaging 0.78
gettysburg UTSW 9 53455988 splice site probably null
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 splice site probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 splice site probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7660:Atm UTSW 9 53445507 missense probably benign 0.01
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
R8221:Atm UTSW 9 53455988 splice site probably null
R8247:Atm UTSW 9 53450570 missense
R8334:Atm UTSW 9 53522273 missense probably benign 0.00
R8503:Atm UTSW 9 53488052 missense probably damaging 0.99
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08