Mutagenetix > Incidental Mutations

Incidental Mutation 'R4665:Parn'

351865

Institutional Source

Beutler Lab

Gene Symbol

Parn

Ensembl Gene

ENSMUSG00000022685

Gene Name

poly(A)-specific ribonuclease (deadenylation nuclease)

Synonyms

DAN, 1200003I18Rik

MMRRC Submission

041923-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R4665 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13537960-13668170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13541103 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 592 (K592E)

Ref Sequence

ENSEMBL: ENSMUSP00000055969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]

Predicted Effect

probably benign
Transcript: ENSMUST00000058884
AA Change: K592E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: K592E

Domain	Start	End	E-Value	Type
Pfam:CAF1	3	383	2.7e-86	PFAM
Pfam:R3H	172	236	2.8e-13	PFAM
Pfam:RNA_bind	430	508	2.2e-37	PFAM
low complexity region	564	578	N/A	INTRINSIC
low complexity region	591	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000231003

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	T	A	6: 86,925,077	M76K	probably null	Het
Abcc4	A	G	14: 118,529,002	I886T	probably benign	Het
Adam6a	T	C	12: 113,544,372	Y122H	possibly damaging	Het
Adgre1	A	G	17: 57,480,947	T905A	probably benign	Het
Arap2	A	G	5: 62,669,969	F969L	possibly damaging	Het
Arhgef4	G	T	1: 34,806,032	G1439V	possibly damaging	Het
Atm	A	G	9: 53,464,229	W2097R	probably benign	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
AU016765	T	A	17: 64,519,921		noncoding transcript	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdc42bpa	A	G	1: 180,144,565	T527A	probably damaging	Het
Chmp7	A	T	14: 69,720,955	V255D	probably damaging	Het
Cldn12	A	G	5: 5,508,385	F14S	probably damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Crygn	T	A	5: 24,751,021		probably benign	Het
Csde1	C	T	3: 103,047,072	T386M	probably damaging	Het
Cux1	G	A	5: 136,286,799	T1129I	probably damaging	Het
Dcaf10	G	A	4: 45,372,769	R394Q	possibly damaging	Het
Dhx16	T	C	17: 35,879,943	V11A	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Eif5b	A	G	1: 38,045,712	E880G	probably damaging	Het
Eml6	A	T	11: 29,819,007	Y67*	probably null	Het
Faim2	C	A	15: 99,524,700		probably null	Het
Faim2	T	G	15: 99,524,701	S72R	probably benign	Het
Fam103a1	C	T	7: 81,768,430	R78W	probably damaging	Het
Fam160a1	A	T	3: 85,730,681	W104R	probably damaging	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Gak	A	G	5: 108,582,960	I860T	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gdf2	A	G	14: 33,945,451	T377A	probably damaging	Het
Gm2431	A	T	7: 142,257,703	C155S	unknown	Het
Gm37596	G	A	3: 93,692,469	H198Y	probably damaging	Het
Gm5814	A	G	17: 47,410,363	M1V	probably null	Het
Gm5901	C	G	7: 105,377,231	Q69E	possibly damaging	Het
Gm9945	A	G	11: 53,480,375		probably benign	Het
Gmps	T	C	3: 64,001,535	V486A	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Hoxa11	T	A	6: 52,243,503	N267Y	probably damaging	Het
Ifngr2	C	A	16: 91,560,038	H153Q	possibly damaging	Het
Ift172	G	T	5: 31,285,254	Q190K	possibly damaging	Het
Iqch	A	G	9: 63,445,571	V899A	probably damaging	Het
Lactb2	T	C	1: 13,647,400	E133G	probably damaging	Het
Lig3	G	A	11: 82,800,250	V110M	probably damaging	Het
Lin54	C	A	5: 100,453,084	Q262H	possibly damaging	Het
Lingo3	G	A	10: 80,835,538	T186I	probably damaging	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Ly86	T	A	13: 37,375,034	F70I	probably damaging	Het
Mospd2	A	T	X: 164,947,333	S301T	probably benign	Het
Mroh2a	A	C	1: 88,241,618	I672L	probably benign	Het
Myo15	A	T	11: 60,504,879		probably null	Het
Nme8	C	G	13: 19,674,435	A78P	probably damaging	Het
Obscn	C	T	11: 59,124,752	V965M	probably damaging	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Pax6	C	A	2: 105,683,998		probably benign	Het
Pdcd6	A	T	13: 74,317,206	M1K	probably null	Het
Pex11b	T	C	3: 96,643,835	L198P	possibly damaging	Het
Phldb3	C	T	7: 24,611,427	A28V	probably benign	Het
Pkn3	C	A	2: 30,085,457		probably benign	Het
Pknox1	T	C	17: 31,595,326		probably null	Het
Ptprg	A	C	14: 12,215,288	I1092L	possibly damaging	Het
Pxylp1	A	C	9: 96,825,285	I281M	probably damaging	Het
Retreg2	G	T	1: 75,144,666	L195F	probably damaging	Het
Rgs20	G	C	1: 5,021,008	F66L	probably benign	Het
Ripk4	C	T	16: 97,755,073	V157I	probably damaging	Het
Ryr2	T	C	13: 11,750,685		probably null	Het
Scaper	A	T	9: 55,912,055	S125R	probably damaging	Het
Sec16a	C	T	2: 26,412,958		probably benign	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a12	T	A	6: 121,359,013		probably benign	Het
Slc9a5	A	G	8: 105,368,128	K784E	probably damaging	Het
Snd1	T	C	6: 28,707,054	V455A	probably damaging	Het
Ssbp2	A	T	13: 91,539,335	I46L	possibly damaging	Het
Stil	A	G	4: 115,041,644	D1157G	probably benign	Het
Tax1bp1	T	A	6: 52,737,131	C271S	probably benign	Het
Tdrd6	T	A	17: 43,624,116	M2014L	probably benign	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Tpr	C	T	1: 150,444,399	R2233W	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vgll1	A	G	X: 57,092,432	R54G	possibly damaging	Het
Wdr72	A	G	9: 74,210,024	T673A	probably benign	Het
Zfp169	C	T	13: 48,490,863		probably benign	Het
Zfp319	G	A	8: 95,325,573		probably benign	Het

Other mutations in Parn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Parn	APN	16	13667603	missense	probably benign
IGL02030:Parn	APN	16	13664650	splice site	probably null
IGL02179:Parn	APN	16	13667592	missense	probably benign	0.00
IGL02336:Parn	APN	16	13566703	missense	probably damaging	1.00
arlette	UTSW	16	13606171	missense	probably damaging	1.00
PIT4453001:Parn	UTSW	16	13607281	missense	probably benign	0.00
PIT4651001:Parn	UTSW	16	13631567	missense	probably benign	0.25
R0388:Parn	UTSW	16	13654476	missense	possibly damaging	0.72
R0485:Parn	UTSW	16	13654435	splice site	probably benign
R0625:Parn	UTSW	16	13640294	missense	probably benign	0.02
R1104:Parn	UTSW	16	13667585	missense	probably damaging	0.99
R1299:Parn	UTSW	16	13664729	missense	probably benign	0.10
R1356:Parn	UTSW	16	13650674	nonsense	probably null
R2067:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2111:Parn	UTSW	16	13603069	missense	probably damaging	1.00
R2397:Parn	UTSW	16	13566654	missense	probably benign
R4473:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4474:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4475:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4476:Parn	UTSW	16	13664685	missense	probably benign	0.00
R4795:Parn	UTSW	16	13606202	missense	probably benign	0.06
R5122:Parn	UTSW	16	13654447	critical splice donor site	probably null
R5226:Parn	UTSW	16	13625552	missense	probably benign
R5355:Parn	UTSW	16	13668022	missense	possibly damaging	0.92
R5570:Parn	UTSW	16	13665930	missense	probably damaging	0.98
R5979:Parn	UTSW	16	13606171	missense	probably damaging	1.00
R6009:Parn	UTSW	16	13667564	missense	probably damaging	1.00
R6173:Parn	UTSW	16	13651811	missense	possibly damaging	0.82
R6493:Parn	UTSW	16	13656925	missense	probably damaging	1.00
R7055:Parn	UTSW	16	13626134	missense	possibly damaging	0.80
R7278:Parn	UTSW	16	13626063	splice site	probably null
R7391:Parn	UTSW	16	13668006	splice site	probably null
R7706:Parn	UTSW	16	13607253	missense	probably damaging	1.00
R8188:Parn	UTSW	16	13541156	missense	probably benign	0.01
R8317:Parn	UTSW	16	13541100	missense	probably damaging	0.96
R8326:Parn	UTSW	16	13665971	missense	probably benign	0.00
R8419:Parn	UTSW	16	13648474	missense	probably benign	0.11
R8433:Parn	UTSW	16	13667549	missense	probably damaging	1.00
R8475:Parn	UTSW	16	13607249	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCAATACATCAGGCCCATGG -3'
(R):5'- CAGTGACACGTTGATAGGGTC -3'

Sequencing Primer
(F):5'- GGTACCACGTGGGGGTTG -3'
(R):5'- ATGTCTGAGGCATGTCCCAG -3'

Posted On

2015-10-08