Incidental Mutation 'R4665:Tdrd6'
ID351868
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission 041923-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4665 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43624116 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 2014 (M2014L)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably benign
Transcript: ENSMUST00000045717
AA Change: M2014L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: M2014L

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162232
Predicted Effect probably benign
Transcript: ENSMUST00000168073
AA Change: M2014L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: M2014L

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,925,077 M76K probably null Het
Abcc4 A G 14: 118,529,002 I886T probably benign Het
Adam6a T C 12: 113,544,372 Y122H possibly damaging Het
Adgre1 A G 17: 57,480,947 T905A probably benign Het
Arap2 A G 5: 62,669,969 F969L possibly damaging Het
Arhgef4 G T 1: 34,806,032 G1439V possibly damaging Het
Atm A G 9: 53,464,229 W2097R probably benign Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
AU016765 T A 17: 64,519,921 noncoding transcript Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Chmp7 A T 14: 69,720,955 V255D probably damaging Het
Cldn12 A G 5: 5,508,385 F14S probably damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Crygn T A 5: 24,751,021 probably benign Het
Csde1 C T 3: 103,047,072 T386M probably damaging Het
Cux1 G A 5: 136,286,799 T1129I probably damaging Het
Dcaf10 G A 4: 45,372,769 R394Q possibly damaging Het
Dhx16 T C 17: 35,879,943 V11A probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Eif5b A G 1: 38,045,712 E880G probably damaging Het
Eml6 A T 11: 29,819,007 Y67* probably null Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam103a1 C T 7: 81,768,430 R78W probably damaging Het
Fam160a1 A T 3: 85,730,681 W104R probably damaging Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Gak A G 5: 108,582,960 I860T probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gdf2 A G 14: 33,945,451 T377A probably damaging Het
Gm2431 A T 7: 142,257,703 C155S unknown Het
Gm37596 G A 3: 93,692,469 H198Y probably damaging Het
Gm5814 A G 17: 47,410,363 M1V probably null Het
Gm5901 C G 7: 105,377,231 Q69E possibly damaging Het
Gm9945 A G 11: 53,480,375 probably benign Het
Gmps T C 3: 64,001,535 V486A probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Hoxa11 T A 6: 52,243,503 N267Y probably damaging Het
Ifngr2 C A 16: 91,560,038 H153Q possibly damaging Het
Ift172 G T 5: 31,285,254 Q190K possibly damaging Het
Iqch A G 9: 63,445,571 V899A probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lig3 G A 11: 82,800,250 V110M probably damaging Het
Lin54 C A 5: 100,453,084 Q262H possibly damaging Het
Lingo3 G A 10: 80,835,538 T186I probably damaging Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Ly86 T A 13: 37,375,034 F70I probably damaging Het
Mospd2 A T X: 164,947,333 S301T probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Myo15 A T 11: 60,504,879 probably null Het
Nme8 C G 13: 19,674,435 A78P probably damaging Het
Obscn C T 11: 59,124,752 V965M probably damaging Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Parn T C 16: 13,541,103 K592E probably benign Het
Pax6 C A 2: 105,683,998 probably benign Het
Pdcd6 A T 13: 74,317,206 M1K probably null Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Phldb3 C T 7: 24,611,427 A28V probably benign Het
Pkn3 C A 2: 30,085,457 probably benign Het
Pknox1 T C 17: 31,595,326 probably null Het
Ptprg A C 14: 12,215,288 I1092L possibly damaging Het
Pxylp1 A C 9: 96,825,285 I281M probably damaging Het
Retreg2 G T 1: 75,144,666 L195F probably damaging Het
Rgs20 G C 1: 5,021,008 F66L probably benign Het
Ripk4 C T 16: 97,755,073 V157I probably damaging Het
Ryr2 T C 13: 11,750,685 probably null Het
Scaper A T 9: 55,912,055 S125R probably damaging Het
Sec16a C T 2: 26,412,958 probably benign Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a12 T A 6: 121,359,013 probably benign Het
Slc9a5 A G 8: 105,368,128 K784E probably damaging Het
Snd1 T C 6: 28,707,054 V455A probably damaging Het
Ssbp2 A T 13: 91,539,335 I46L possibly damaging Het
Stil A G 4: 115,041,644 D1157G probably benign Het
Tax1bp1 T A 6: 52,737,131 C271S probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Tpr C T 1: 150,444,399 R2233W probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vgll1 A G X: 57,092,432 R54G possibly damaging Het
Wdr72 A G 9: 74,210,024 T673A probably benign Het
Zfp169 C T 13: 48,490,863 probably benign Het
Zfp319 G A 8: 95,325,573 probably benign Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R8002:Tdrd6 UTSW 17 43629819 missense not run
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense not run
Predicted Primers PCR Primer
(F):5'- GCCAAGTCTGCTCTAGAGAG -3'
(R):5'- TTCTGATGATGACCACAGCAGG -3'

Sequencing Primer
(F):5'- GCTTTCCTTCTAAAACCAAAACAAG -3'
(R):5'- ACAGCAGGTCTCCCCTC -3'
Posted On2015-10-08