Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Serpinb13'

351876

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

MMRRC Submission

041924-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 106982844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 66 (S66L)

Ref Sequence

ENSEMBL: ENSMUSP00000118572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027564
AA Change: S66L

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136766
AA Change: S66L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: S66L

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
R9375:Serpinb13	UTSW	1	106982267	missense	probably damaging	1.00
R9774:Serpinb13	UTSW	1	106995849	missense	probably benign	0.02
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGGCAACATAGACATTTCTCTGG -3'
(R):5'- TCCAGGAGCTTTTGAGCAAG -3'

Sequencing Primer
(F):5'- AGACATTTCTCTGGCTTTTCAAGGAG -3'
(R):5'- AGCCTCTAGGACTTTGTTATAGCAGC -3'

Posted On

2015-10-08