Incidental Mutation 'R4666:Olfr1122'
ID 351884
Institutional Source Beutler Lab
Gene Symbol Olfr1122
Ensembl Gene ENSMUSG00000047594
Gene Name olfactory receptor 1122
Synonyms GA_x6K02T2Q125-48880078-48881058, MOR264-1
MMRRC Submission 041924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 87385849-87391930 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87387876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 57 (I57K)
Ref Sequence ENSEMBL: ENSMUSP00000149403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056435] [ENSMUST00000215371]
AlphaFold Q8VGT9
Predicted Effect probably damaging
Transcript: ENSMUST00000056435
AA Change: I57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052190
Gene: ENSMUSG00000047594
AA Change: I57K

Pfam:7tm_4 43 319 6.3e-51 PFAM
Pfam:7tm_1 53 302 5.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215371
AA Change: I57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Olfr1122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1122 APN 2 87387843 missense possibly damaging 0.91
IGL01783:Olfr1122 APN 2 87387838 missense probably benign 0.39
IGL02396:Olfr1122 APN 2 87387705 utr 5 prime probably benign
IGL03338:Olfr1122 APN 2 87388126 missense probably benign 0.05
IGL03373:Olfr1122 APN 2 87388233 missense probably damaging 1.00
R0594:Olfr1122 UTSW 2 87387954 missense probably damaging 1.00
R1245:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1471:Olfr1122 UTSW 2 87388518 missense probably damaging 1.00
R1681:Olfr1122 UTSW 2 87388620 missense possibly damaging 0.95
R1995:Olfr1122 UTSW 2 87387831 missense probably damaging 0.97
R2246:Olfr1122 UTSW 2 87387851 missense probably benign 0.00
R2341:Olfr1122 UTSW 2 87387740 missense probably benign
R4008:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4009:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4011:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4119:Olfr1122 UTSW 2 87387843 missense possibly damaging 0.91
R4547:Olfr1122 UTSW 2 87388160 missense probably benign 0.07
R4665:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4801:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R4802:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R5049:Olfr1122 UTSW 2 87388658 missense probably benign 0.00
R5070:Olfr1122 UTSW 2 87388163 missense probably damaging 1.00
R7594:Olfr1122 UTSW 2 87388269 missense probably damaging 1.00
R7684:Olfr1122 UTSW 2 87388028 missense probably damaging 0.99
R8064:Olfr1122 UTSW 2 87388509 missense probably benign 0.00
R8218:Olfr1122 UTSW 2 87388578 missense probably damaging 0.99
R8282:Olfr1122 UTSW 2 87388508 missense probably benign 0.01
R8335:Olfr1122 UTSW 2 87387860 missense probably benign 0.02
R9800:Olfr1122 UTSW 2 87388164 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-10-08