Incidental Mutation 'R4666:Ube2v1'
ID 351889
Institutional Source Beutler Lab
Gene Symbol Ube2v1
Ensembl Gene ENSMUSG00000078923
Gene Name ubiquitin-conjugating enzyme E2 variant 1
Synonyms D7Bwg1382e, CROC1, 0610011J09Rik
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 167449559-167473933 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 167452297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 102 (Y102F)
Ref Sequence ENSEMBL: ENSMUSP00000116578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060645] [ENSMUST00000109207] [ENSMUST00000125544] [ENSMUST00000140216] [ENSMUST00000151365]
AlphaFold Q9CZY3
Predicted Effect probably benign
Transcript: ENSMUST00000060645
SMART Domains Protein: ENSMUSP00000053109
Gene: ENSMUSG00000078923

DomainStartEndE-ValueType
PDB:2C2V|L 7 105 7e-59 PDB
SCOP:d1jatb_ 10 103 4e-31 SMART
Blast:UBCc 15 105 1e-54 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109207
AA Change: Y75F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104830
Gene: ENSMUSG00000078923
AA Change: Y75F

DomainStartEndE-ValueType
UBCc 15 147 1.53e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125544
AA Change: Y299F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118416
Gene: ENSMUSG00000089739
AA Change: Y299F

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
UBCc 239 371 1.53e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130284
Predicted Effect probably damaging
Transcript: ENSMUST00000140216
AA Change: Y102F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116578
Gene: ENSMUSG00000078923
AA Change: Y102F

DomainStartEndE-ValueType
UBCc 42 125 6.78e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144628
Predicted Effect possibly damaging
Transcript: ENSMUST00000151365
AA Change: Y101F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114764
Gene: ENSMUSG00000078923
AA Change: Y101F

DomainStartEndE-ValueType
UBCc 41 173 1.53e-14 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-conjugating E2 enzyme variant proteins constitute a distinct subfamily within the E2 protein family. They have sequence similarity to other ubiquitin-conjugating enzymes but lack the conserved cysteine residue that is critical for the catalytic activity of E2s. The protein encoded by this gene is located in the nucleus and can cause transcriptional activation of the human FOS proto-oncogene. It is thought to be involved in the control of differentiation by altering cell cycle behavior. Alternatively spliced transcript variants encoding multiple isoforms have been described for this gene, and multiple pseudogenes of this gene have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (Kua-UEV), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Ube2v1
AlleleSourceChrCoordTypePredicted EffectPPH Score
ANU74:Ube2v1 UTSW 2 167,452,264 (GRCm39) missense probably damaging 1.00
R1219:Ube2v1 UTSW 2 167,459,831 (GRCm39) missense probably benign 0.20
R2862:Ube2v1 UTSW 2 167,459,885 (GRCm39) missense probably damaging 1.00
R2971:Ube2v1 UTSW 2 167,452,256 (GRCm39) missense probably damaging 1.00
R4894:Ube2v1 UTSW 2 167,452,280 (GRCm39) missense probably damaging 0.99
R6150:Ube2v1 UTSW 2 167,459,874 (GRCm39) nonsense probably null
R7260:Ube2v1 UTSW 2 167,471,114 (GRCm39) missense probably benign 0.02
R7356:Ube2v1 UTSW 2 167,451,115 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTGCCATGGACACTGAACAC -3'
(R):5'- GTCGGACTCATTGACACTTAAC -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGACTAGGCTG -3'
(R):5'- TCGGACTCATTGACACTTAACCCTAG -3'
Posted On 2015-10-08