Incidental Mutation 'R4666:Chrna4'
ID 351890
Institutional Source Beutler Lab
Gene Symbol Chrna4
Ensembl Gene ENSMUSG00000027577
Gene Name cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms alpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR
MMRRC Submission 041924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 181018380-181043546 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181037493 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 54 (S54P)
Ref Sequence ENSEMBL: ENSMUSP00000104479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851] [ENSMUST00000124400]
AlphaFold O70174
Predicted Effect probably damaging
Transcript: ENSMUST00000067120
AA Change: S54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: S54P

signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 1.4e-76 PFAM
Pfam:Neur_chan_memb 252 620 1.9e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108851
AA Change: S54P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: S54P

signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124400
AA Change: S37P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123043
Gene: ENSMUSG00000027577
AA Change: S37P

Pfam:Neur_chan_LBD 22 78 3.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135766
SMART Domains Protein: ENSMUSP00000125724
Gene: ENSMUSG00000027577

signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 130 9.2e-37 PFAM
Meta Mutation Damage Score 0.6455 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Chrna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Chrna4 APN 2 181029391 missense probably benign 0.09
IGL00914:Chrna4 APN 2 181029031 missense probably damaging 1.00
IGL01511:Chrna4 APN 2 181028668 missense probably benign 0.13
IGL02517:Chrna4 APN 2 181029133 missense probably benign 0.01
IGL02715:Chrna4 APN 2 181029581 unclassified probably benign
R1168:Chrna4 UTSW 2 181034138 missense possibly damaging 0.61
R1475:Chrna4 UTSW 2 181029379 missense probably benign 0.44
R1572:Chrna4 UTSW 2 181029307 missense possibly damaging 0.95
R4428:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4429:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4431:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4494:Chrna4 UTSW 2 181028488 missense probably damaging 0.98
R4664:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4931:Chrna4 UTSW 2 181028872 missense probably benign 0.00
R5144:Chrna4 UTSW 2 181024830 missense probably damaging 1.00
R5556:Chrna4 UTSW 2 181033980 missense possibly damaging 0.94
R5633:Chrna4 UTSW 2 181029460 missense probably damaging 1.00
R5889:Chrna4 UTSW 2 181028658 missense probably damaging 1.00
R6056:Chrna4 UTSW 2 181029442 missense probably damaging 1.00
R6120:Chrna4 UTSW 2 181024806 missense probably damaging 1.00
R7030:Chrna4 UTSW 2 181029541 missense probably damaging 1.00
R7352:Chrna4 UTSW 2 181037474 missense probably damaging 0.97
R7694:Chrna4 UTSW 2 181018593 missense
R7945:Chrna4 UTSW 2 181028661 missense probably benign 0.04
R8075:Chrna4 UTSW 2 181039066 missense unknown
R8706:Chrna4 UTSW 2 181037514 missense probably damaging 1.00
R9091:Chrna4 UTSW 2 181028850 missense possibly damaging 0.79
R9138:Chrna4 UTSW 2 181028982 missense probably damaging 0.97
R9154:Chrna4 UTSW 2 181028809 missense probably damaging 0.99
R9270:Chrna4 UTSW 2 181028850 missense possibly damaging 0.79
R9598:Chrna4 UTSW 2 181037471 missense probably damaging 1.00
Z1177:Chrna4 UTSW 2 181024813 missense probably damaging 1.00
Z1177:Chrna4 UTSW 2 181028285 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-10-08