Incidental Mutation 'R4666:Uckl1'
ID 351891
Institutional Source Beutler Lab
Gene Symbol Uckl1
Ensembl Gene ENSMUSG00000089917
Gene Name uridine-cytidine kinase 1-like 1
Synonyms Urkl1, 1110007H10Rik
MMRRC Submission 041924-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 181569149-181584892 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181574868 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 95 (S95T)
Ref Sequence ENSEMBL: ENSMUSP00000121607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000136875] [ENSMUST00000154613]
AlphaFold Q91YL3
Predicted Effect possibly damaging
Transcript: ENSMUST00000057816
AA Change: S95T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917
AA Change: S95T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126672
Predicted Effect possibly damaging
Transcript: ENSMUST00000129469
AA Change: S95T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917
AA Change: S95T

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130893
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000134340
SMART Domains Protein: ENSMUSP00000122098
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
Pfam:UPRTase 1 182 9.8e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136875
AA Change: S80T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114821
Gene: ENSMUSG00000089917
AA Change: S80T

DomainStartEndE-ValueType
Pfam:CPT 83 211 2.3e-10 PFAM
Pfam:AAA_17 85 235 4.9e-9 PFAM
Pfam:PRK 85 235 8.4e-47 PFAM
Pfam:AAA_18 86 235 2.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect unknown
Transcript: ENSMUST00000144856
AA Change: S79T
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917
AA Change: S79T

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155182
Predicted Effect probably benign
Transcript: ENSMUST00000154613
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Uckl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Uckl1 APN 2 181569617 missense probably benign 0.09
IGL01128:Uckl1 APN 2 181570337 missense probably damaging 1.00
IGL01325:Uckl1 APN 2 181574961 nonsense probably null
IGL01767:Uckl1 APN 2 181569534 missense probably damaging 1.00
IGL02260:Uckl1 APN 2 181569588 missense probably damaging 1.00
IGL02390:Uckl1 APN 2 181574419 missense possibly damaging 0.59
IGL03369:Uckl1 APN 2 181570189 missense probably benign 0.00
R0001:Uckl1 UTSW 2 181574655 missense probably damaging 1.00
R0528:Uckl1 UTSW 2 181570490 splice site probably benign
R1037:Uckl1 UTSW 2 181572485 missense possibly damaging 0.67
R1355:Uckl1 UTSW 2 181573376 missense probably damaging 1.00
R1416:Uckl1 UTSW 2 181569569 missense possibly damaging 0.79
R1435:Uckl1 UTSW 2 181573133 missense probably benign 0.01
R1676:Uckl1 UTSW 2 181574918 missense probably damaging 1.00
R1723:Uckl1 UTSW 2 181570600 critical splice acceptor site probably null
R1954:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R1955:Uckl1 UTSW 2 181570527 missense probably benign 0.17
R3972:Uckl1 UTSW 2 181574463 missense probably damaging 0.98
R4664:Uckl1 UTSW 2 181574868 missense possibly damaging 0.91
R5306:Uckl1 UTSW 2 181574367 critical splice donor site probably null
R5751:Uckl1 UTSW 2 181574452 missense possibly damaging 0.81
R5758:Uckl1 UTSW 2 181569953 missense probably damaging 1.00
R6174:Uckl1 UTSW 2 181573073 critical splice donor site probably null
R6662:Uckl1 UTSW 2 181573260 missense possibly damaging 0.87
R6865:Uckl1 UTSW 2 181574493 missense probably damaging 1.00
R7051:Uckl1 UTSW 2 181574244 missense probably damaging 1.00
R7643:Uckl1 UTSW 2 181573106 missense probably benign 0.08
R7818:Uckl1 UTSW 2 181574667 missense probably damaging 0.97
R8094:Uckl1 UTSW 2 181573256 missense probably damaging 1.00
R8341:Uckl1 UTSW 2 181569719 missense probably benign 0.00
R8515:Uckl1 UTSW 2 181574487 missense probably damaging 1.00
R8980:Uckl1 UTSW 2 181574364 unclassified probably benign
R9108:Uckl1 UTSW 2 181569500 missense probably damaging 0.97
R9377:Uckl1 UTSW 2 181569739 missense probably damaging 1.00
RF014:Uckl1 UTSW 2 181570194 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCATGGACAACAGGACC -3'
(R):5'- CTGAGGCTAAGCACATTCCTC -3'

Sequencing Primer
(F):5'- CCACCCAGGGCACATCTAG -3'
(R):5'- CTCTTTACAGCAGCAATGCAGGG -3'
Posted On 2015-10-08