Incidental Mutation 'R4666:Spag8'
ID 351894
Institutional Source Beutler Lab
Gene Symbol Spag8
Ensembl Gene ENSMUSG00000066196
Gene Name sperm associated antigen 8
Synonyms
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43651335-43653594 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 43653408 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
AlphaFold Q3V0Q6
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030192
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000084646
AA Change: Q18K
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196
AA Change: Q18K

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107870
AA Change: Q18K
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196
AA Change: Q18K

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Spag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Spag8 APN 4 43,652,890 (GRCm39) nonsense probably null
IGL01766:Spag8 APN 4 43,653,209 (GRCm39) unclassified probably benign
IGL02043:Spag8 APN 4 43,653,134 (GRCm39) unclassified probably benign
IGL02324:Spag8 APN 4 43,651,781 (GRCm39) missense probably damaging 1.00
IGL02812:Spag8 APN 4 43,651,755 (GRCm39) missense probably damaging 0.96
IGL03336:Spag8 APN 4 43,652,114 (GRCm39) splice site probably benign
R1519:Spag8 UTSW 4 43,652,777 (GRCm39) missense possibly damaging 0.88
R1799:Spag8 UTSW 4 43,653,345 (GRCm39) unclassified probably benign
R1799:Spag8 UTSW 4 43,653,087 (GRCm39) unclassified probably benign
R2212:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R2338:Spag8 UTSW 4 43,652,826 (GRCm39) missense probably benign 0.06
R3412:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R3413:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R3414:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R4670:Spag8 UTSW 4 43,653,378 (GRCm39) unclassified probably benign
R4745:Spag8 UTSW 4 43,651,636 (GRCm39) missense probably damaging 0.98
R4795:Spag8 UTSW 4 43,652,035 (GRCm39) missense possibly damaging 0.55
R5409:Spag8 UTSW 4 43,653,134 (GRCm39) unclassified probably benign
R5992:Spag8 UTSW 4 43,651,534 (GRCm39) missense probably benign 0.06
R6192:Spag8 UTSW 4 43,652,458 (GRCm39) missense probably damaging 1.00
R6333:Spag8 UTSW 4 43,653,186 (GRCm39) unclassified probably benign
R7216:Spag8 UTSW 4 43,652,034 (GRCm39) missense possibly damaging 0.55
R8923:Spag8 UTSW 4 43,651,471 (GRCm39) missense probably damaging 0.99
R8996:Spag8 UTSW 4 43,651,998 (GRCm39) missense probably damaging 1.00
R9116:Spag8 UTSW 4 43,653,231 (GRCm39) missense unknown
R9705:Spag8 UTSW 4 43,652,366 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCCATGGCCTCTATGATGG -3'
(R):5'- AGAGCGTTTGTTTATCTCTGCTAC -3'

Sequencing Primer
(F):5'- CATGGCCTCTATGATGGGCTGG -3'
(R):5'- CGCAGTCTCCTGGAGTTG -3'
Posted On 2015-10-08