Incidental Mutation 'R4666:Spag8'
ID 351894
Institutional Source Beutler Lab
Gene Symbol Spag8
Ensembl Gene ENSMUSG00000066196
Gene Name sperm associated antigen 8
Synonyms
MMRRC Submission 041924-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43651335-43653594 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 43653408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
AlphaFold Q3V0Q6
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030192
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000084646
AA Change: Q18K
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196
AA Change: Q18K

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107870
AA Change: Q18K
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196
AA Change: Q18K

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Spag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Spag8 APN 4 43652890 nonsense probably null
IGL01766:Spag8 APN 4 43653209 unclassified probably benign
IGL02043:Spag8 APN 4 43653134 unclassified probably benign
IGL02324:Spag8 APN 4 43651781 missense probably damaging 1.00
IGL02812:Spag8 APN 4 43651755 missense probably damaging 0.96
IGL03336:Spag8 APN 4 43652114 splice site probably benign
R1519:Spag8 UTSW 4 43652777 missense possibly damaging 0.88
R1799:Spag8 UTSW 4 43653087 unclassified probably benign
R1799:Spag8 UTSW 4 43653345 unclassified probably benign
R2212:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R2338:Spag8 UTSW 4 43652826 missense probably benign 0.06
R3412:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3413:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R3414:Spag8 UTSW 4 43651606 missense probably damaging 1.00
R4670:Spag8 UTSW 4 43653378 unclassified probably benign
R4745:Spag8 UTSW 4 43651636 missense probably damaging 0.98
R4795:Spag8 UTSW 4 43652035 missense possibly damaging 0.55
R5409:Spag8 UTSW 4 43653134 unclassified probably benign
R5992:Spag8 UTSW 4 43651534 missense probably benign 0.06
R6192:Spag8 UTSW 4 43652458 missense probably damaging 1.00
R6333:Spag8 UTSW 4 43653186 unclassified probably benign
R7216:Spag8 UTSW 4 43652034 missense possibly damaging 0.55
R8923:Spag8 UTSW 4 43651471 missense probably damaging 0.99
R8996:Spag8 UTSW 4 43651998 missense probably damaging 1.00
R9116:Spag8 UTSW 4 43653231 missense unknown
R9705:Spag8 UTSW 4 43652366 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCCATGGCCTCTATGATGG -3'
(R):5'- AGAGCGTTTGTTTATCTCTGCTAC -3'

Sequencing Primer
(F):5'- CATGGCCTCTATGATGGGCTGG -3'
(R):5'- CGCAGTCTCCTGGAGTTG -3'
Posted On 2015-10-08