Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Tmprss11d'

351905

Institutional Source

Beutler Lab

Gene Symbol

Tmprss11d

Ensembl Gene

ENSMUSG00000061259

Gene Name

transmembrane protease, serine 11d

Synonyms

AsP

MMRRC Submission

041924-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86302217-86373420 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86309401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 133 (D133G)

Ref Sequence

ENSEMBL: ENSMUSP00000113079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]

AlphaFold

Q8VHK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000031175
AA Change: D271G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: D271G

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
SEA	41	164	4.92e-2	SMART
Tryp_SPc	185	411	1.29e-86	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000122377
AA Change: D133G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259
AA Change: D133G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Tryp_SPc	47	273	1.29e-86	SMART

Meta Mutation Damage Score

0.9038

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Tmprss11d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02393:Tmprss11d	APN	5	86303612	makesense	probably null
IGL02519:Tmprss11d	APN	5	86306305	missense	probably damaging	1.00
IGL02666:Tmprss11d	APN	5	86331193	missense	probably damaging	1.00
IGL02974:Tmprss11d	APN	5	86306376	missense	probably damaging	1.00
IGL03305:Tmprss11d	APN	5	86326420	missense	probably damaging	1.00
R0440:Tmprss11d	UTSW	5	86338812	missense	probably damaging	0.96
R1261:Tmprss11d	UTSW	5	86309380	missense	possibly damaging	0.52
R1544:Tmprss11d	UTSW	5	86338799	missense	probably damaging	1.00
R2018:Tmprss11d	UTSW	5	86339554	missense	probably damaging	0.97
R2036:Tmprss11d	UTSW	5	86309269	missense	probably damaging	0.97
R2267:Tmprss11d	UTSW	5	86373349	missense	probably benign	0.01
R4063:Tmprss11d	UTSW	5	86309318	missense	probably benign	0.04
R4087:Tmprss11d	UTSW	5	86309279	missense	probably damaging	1.00
R4665:Tmprss11d	UTSW	5	86309401	missense	probably damaging	1.00
R4784:Tmprss11d	UTSW	5	86306281	missense	probably damaging	0.99
R4785:Tmprss11d	UTSW	5	86306281	missense	probably damaging	0.99
R5077:Tmprss11d	UTSW	5	86309263	critical splice donor site	probably null
R5201:Tmprss11d	UTSW	5	86309355	missense	possibly damaging	0.92
R5350:Tmprss11d	UTSW	5	86338887	missense	probably benign	0.08
R5523:Tmprss11d	UTSW	5	86338870	missense	probably benign	0.05
R5618:Tmprss11d	UTSW	5	86306295	missense	probably benign
R5643:Tmprss11d	UTSW	5	86326529	missense	probably benign	0.00
R5834:Tmprss11d	UTSW	5	86306310	missense	probably damaging	1.00
R6422:Tmprss11d	UTSW	5	86309425	missense	probably damaging	1.00
R6706:Tmprss11d	UTSW	5	86331103	missense	probably benign	0.03
R6735:Tmprss11d	UTSW	5	86309300	missense	probably damaging	1.00
R6778:Tmprss11d	UTSW	5	86309350	missense	probably benign	0.34
R7013:Tmprss11d	UTSW	5	86326573	missense	probably damaging	0.99
R7273:Tmprss11d	UTSW	5	86337239	missense	probably damaging	1.00
R7488:Tmprss11d	UTSW	5	86326450	missense	probably damaging	1.00
R7627:Tmprss11d	UTSW	5	86309506	missense	possibly damaging	0.73
R7742:Tmprss11d	UTSW	5	86303634	missense	probably damaging	0.98
R7937:Tmprss11d	UTSW	5	86309490	missense	probably benign	0.06
R8419:Tmprss11d	UTSW	5	86309306	missense	probably damaging	1.00
R8794:Tmprss11d	UTSW	5	86338821	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTTCCTCATCTGAGAACTGAC -3'
(R):5'- CCCATGTGAAGTGATGTTGAATTC -3'

Sequencing Primer
(F):5'- CTGGTCTACACAGTGGATTCCAAG -3'
(R):5'- CAATATTGGACAGCCACCT -3'

Posted On

2015-10-08