Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Gtf2ird1'

351910

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird1

Ensembl Gene

ENSMUSG00000023079

Gene Name

general transcription factor II I repeat domain-containing 1

Synonyms

binding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN

MMRRC Submission

041924-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134357656-134456716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 134383902 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 55 (E55V)

Ref Sequence

ENSEMBL: ENSMUSP00000144420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554]

AlphaFold

Q9JI57

Predicted Effect

probably damaging
Transcript: ENSMUST00000073161
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	814	889	1.7e-34	PFAM
Pfam:GTF2I	917	992	1.7e-34	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074114
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.5e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	690	765	2.8e-34	PFAM
Pfam:GTF2I	814	889	1.6e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100650
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.5e-29	PFAM
Pfam:GTF2I	351	426	4.9e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.2e-34	PFAM
Pfam:GTF2I	690	765	3.1e-34	PFAM
Pfam:GTF2I	787	862	1.8e-34	PFAM
Pfam:GTF2I	890	965	1.8e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100652
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.8e-29	PFAM
Pfam:GTF2I	351	425	6.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.3e-34	PFAM
Pfam:GTF2I	690	764	3.3e-32	PFAM
Pfam:GTF2I	814	888	3e-33	PFAM
Pfam:GTF2I	917	991	3e-33	PFAM
low complexity region	1020	1043	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100654
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	716	791	1.5e-34	PFAM
Pfam:GTF2I	819	894	1.5e-34	PFAM
low complexity region	922	945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111244
AA Change: E585V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.3e-29	PFAM
Pfam:GTF2I	351	425	4.9e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1.7e-34	PFAM
Pfam:GTF2I	690	764	2.5e-32	PFAM
Pfam:GTF2I	787	861	2.3e-33	PFAM
Pfam:GTF2I	890	964	2.3e-33	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111245
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.4e-29	PFAM
Pfam:GTF2I	351	426	4.6e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1.1e-34	PFAM
Pfam:GTF2I	671	746	2.9e-34	PFAM
Pfam:GTF2I	768	843	1.7e-34	PFAM
Pfam:GTF2I	871	946	1.7e-34	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167084
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.3e-29	PFAM
Pfam:GTF2I	351	426	4.3e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	1e-34	PFAM
Pfam:GTF2I	690	765	2.7e-34	PFAM
Pfam:GTF2I	814	889	1.5e-34	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171794
AA Change: E585V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	203	1.2e-29	PFAM
Pfam:GTF2I	351	426	3.8e-33	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	640	8.9e-35	PFAM
Pfam:GTF2I	690	765	2.4e-34	PFAM
Pfam:GTF2I	787	862	1.4e-34	PFAM
Pfam:GTF2I	890	965	1.4e-34	PFAM
low complexity region	993	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200817

Predicted Effect

probably damaging
Transcript: ENSMUST00000200944
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	4.9e-29	PFAM
Pfam:GTF2I	351	425	5.6e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2e-34	PFAM
Pfam:GTF2I	690	764	2.8e-32	PFAM
Pfam:GTF2I	814	888	2.6e-33	PFAM
low complexity region	917	940	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000201441
AA Change: E190V

Predicted Effect

unknown
Transcript: ENSMUST00000201447
AA Change: E152V

Predicted Effect

probably benign
Transcript: ENSMUST00000201495

Predicted Effect

probably damaging
Transcript: ENSMUST00000202165
AA Change: E55V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079
AA Change: E55V

Domain	Start	End	E-Value	Type
low complexity region	13	28	N/A	INTRINSIC
Pfam:GTF2I	35	109	7.6e-33	PFAM
Pfam:GTF2I	167	193	4.2e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000202280
AA Change: E585V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	2.6e-26	PFAM
Pfam:GTF2I	351	425	2.9e-29	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	1e-31	PFAM
Pfam:GTF2I	690	764	1.5e-29	PFAM
Pfam:GTF2I	787	861	1.3e-30	PFAM
low complexity region	890	913	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000202321
AA Change: R25S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202335

Predicted Effect

probably damaging
Transcript: ENSMUST00000202554
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: E585V

Domain	Start	End	E-Value	Type
Pfam:GTF2I	128	202	5.5e-29	PFAM
Pfam:GTF2I	351	425	6.3e-32	PFAM
low complexity region	543	558	N/A	INTRINSIC
Pfam:GTF2I	565	639	2.2e-34	PFAM
Pfam:GTF2I	671	745	3.2e-32	PFAM
Pfam:GTF2I	768	842	2.9e-33	PFAM
Pfam:GTF2I	871	945	2.9e-33	PFAM
low complexity region	974	997	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202334

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202202

Predicted Effect

probably benign
Transcript: ENSMUST00000201526

Meta Mutation Damage Score

0.2867

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Gtf2ird1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Gtf2ird1	APN	5	134358891	missense	probably benign	0.03
IGL02477:Gtf2ird1	APN	5	134379978	missense	probably damaging	1.00
IGL02659:Gtf2ird1	APN	5	134377041	missense	probably damaging	1.00
IGL02752:Gtf2ird1	APN	5	134358824	makesense	probably null
IGL02963:Gtf2ird1	APN	5	134389687	missense	probably benign	0.05
IGL03328:Gtf2ird1	APN	5	134389129	critical splice donor site	probably null
IGL03379:Gtf2ird1	APN	5	134382538	missense	possibly damaging	0.94
R0585:Gtf2ird1	UTSW	5	134376942	missense	probably damaging	1.00
R1199:Gtf2ird1	UTSW	5	134411064	missense	possibly damaging	0.85
R1388:Gtf2ird1	UTSW	5	134395710	missense	probably damaging	1.00
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1470:Gtf2ird1	UTSW	5	134395802	critical splice acceptor site	probably null
R1544:Gtf2ird1	UTSW	5	134358918	missense	possibly damaging	0.93
R1652:Gtf2ird1	UTSW	5	134395713	missense	probably damaging	1.00
R1792:Gtf2ird1	UTSW	5	134366936	splice site	probably null
R1852:Gtf2ird1	UTSW	5	134382580	splice site	probably null
R1938:Gtf2ird1	UTSW	5	134415245	missense	probably damaging	1.00
R1996:Gtf2ird1	UTSW	5	134376886	splice site	probably benign
R2020:Gtf2ird1	UTSW	5	134417093	missense	probably damaging	1.00
R2025:Gtf2ird1	UTSW	5	134363934	missense	probably damaging	1.00
R2849:Gtf2ird1	UTSW	5	134359007	missense	probably damaging	1.00
R2964:Gtf2ird1	UTSW	5	134357684	splice site	probably null
R3421:Gtf2ird1	UTSW	5	134388500	missense	probably benign	0.41
R4543:Gtf2ird1	UTSW	5	134363900	critical splice donor site	probably null
R4569:Gtf2ird1	UTSW	5	134411003	missense	probably damaging	1.00
R4664:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4665:Gtf2ird1	UTSW	5	134383902	missense	probably damaging	1.00
R4680:Gtf2ird1	UTSW	5	134357881	missense	probably damaging	1.00
R4709:Gtf2ird1	UTSW	5	134404734	missense	probably benign
R4806:Gtf2ird1	UTSW	5	134383896	missense	probably damaging	0.99
R4823:Gtf2ird1	UTSW	5	134395722	missense	probably damaging	1.00
R4857:Gtf2ird1	UTSW	5	134362544	missense	probably damaging	0.96
R4970:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R4974:Gtf2ird1	UTSW	5	134357831	nonsense	probably null
R4975:Gtf2ird1	UTSW	5	134395627	missense	probably damaging	1.00
R5072:Gtf2ird1	UTSW	5	134390933	splice site	probably null
R5112:Gtf2ird1	UTSW	5	134402184	missense	probably damaging	1.00
R5653:Gtf2ird1	UTSW	5	134410967	missense	probably damaging	1.00
R5681:Gtf2ird1	UTSW	5	134363318	missense	probably damaging	1.00
R5738:Gtf2ird1	UTSW	5	134383818	missense	probably damaging	1.00
R5753:Gtf2ird1	UTSW	5	134410983	missense	probably damaging	1.00
R6385:Gtf2ird1	UTSW	5	134404690	missense	probably benign	0.19
R6580:Gtf2ird1	UTSW	5	134361039	missense	probably damaging	1.00
R6787:Gtf2ird1	UTSW	5	134363912	missense	probably damaging	0.99
R6981:Gtf2ird1	UTSW	5	134383922	splice site	probably benign
R7208:Gtf2ird1	UTSW	5	134411094	missense	probably benign	0.35
R7271:Gtf2ird1	UTSW	5	134404904	missense	probably benign	0.01
R7517:Gtf2ird1	UTSW	5	134362525	missense	probably benign
R7786:Gtf2ird1	UTSW	5	134390899	nonsense	probably null
R7788:Gtf2ird1	UTSW	5	134417131	nonsense	probably null
R7850:Gtf2ird1	UTSW	5	134363215	missense	probably benign	0.21
R7866:Gtf2ird1	UTSW	5	134363209	missense	probably benign	0.01
R8183:Gtf2ird1	UTSW	5	134357835	missense	unknown
R8712:Gtf2ird1	UTSW	5	134415210	missense	probably damaging	1.00
R8844:Gtf2ird1	UTSW	5	134361025	nonsense	probably null
R9473:Gtf2ird1	UTSW	5	134404680	missense	probably benign	0.08
R9669:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
R9737:Gtf2ird1	UTSW	5	134379940	missense	probably damaging	0.99
X0026:Gtf2ird1	UTSW	5	134376102	splice site	probably null
Z1176:Gtf2ird1	UTSW	5	134409312	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTTCCTTGGCTAGCCTGGAAC -3'
(R):5'- CAGACACAGCAGGACTTTCATTC -3'

Sequencing Primer
(F):5'- TGGAACACCCAGCCCAG -3'
(R):5'- CTGCCTGCCGACTACATGTG -3'

Posted On

2015-10-08