Incidental Mutation 'R4666:Gtf2ird1'
ID 351910
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Name general transcription factor II I repeat domain-containing 1
Synonyms ESTM9, BEN, binding factor for early enhancer, MusTRD1, GTF3, Cream1, WBSCR11
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.644) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 134386510-134485570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134412756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 55 (E55V)
Ref Sequence ENSEMBL: ENSMUSP00000144420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554]
AlphaFold Q9JI57
Predicted Effect probably damaging
Transcript: ENSMUST00000073161
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074114
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100650
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100652
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111244
AA Change: E585V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111245
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167084
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171794
AA Change: E585V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201447
AA Change: E152V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200817
Predicted Effect probably damaging
Transcript: ENSMUST00000200944
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202165
AA Change: E55V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079
AA Change: E55V

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202280
AA Change: E585V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202321
AA Change: R25S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202335
Predicted Effect probably damaging
Transcript: ENSMUST00000202554
AA Change: E585V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: E585V

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000201441
AA Change: E190V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202202
Predicted Effect probably benign
Transcript: ENSMUST00000200798
Predicted Effect probably benign
Transcript: ENSMUST00000201526
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Meta Mutation Damage Score 0.2867 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134,387,745 (GRCm39) missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134,408,832 (GRCm39) missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134,405,895 (GRCm39) missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134,387,678 (GRCm39) makesense probably null
IGL02963:Gtf2ird1 APN 5 134,418,541 (GRCm39) missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134,417,983 (GRCm39) critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134,411,392 (GRCm39) missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134,405,796 (GRCm39) missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134,439,918 (GRCm39) missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134,424,564 (GRCm39) missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134,387,772 (GRCm39) missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134,424,567 (GRCm39) missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134,395,790 (GRCm39) splice site probably null
R1852:Gtf2ird1 UTSW 5 134,411,434 (GRCm39) splice site probably null
R1938:Gtf2ird1 UTSW 5 134,444,099 (GRCm39) missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134,405,740 (GRCm39) splice site probably benign
R2020:Gtf2ird1 UTSW 5 134,445,947 (GRCm39) missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134,392,788 (GRCm39) missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134,387,861 (GRCm39) missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134,386,538 (GRCm39) splice site probably null
R3421:Gtf2ird1 UTSW 5 134,417,354 (GRCm39) missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134,392,754 (GRCm39) critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134,439,857 (GRCm39) missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134,386,735 (GRCm39) missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134,433,588 (GRCm39) missense probably benign
R4806:Gtf2ird1 UTSW 5 134,412,750 (GRCm39) missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134,424,576 (GRCm39) missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134,391,398 (GRCm39) missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134,386,685 (GRCm39) nonsense probably null
R4975:Gtf2ird1 UTSW 5 134,424,481 (GRCm39) missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134,419,787 (GRCm39) splice site probably null
R5112:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134,439,821 (GRCm39) missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134,392,172 (GRCm39) missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134,412,672 (GRCm39) missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134,439,837 (GRCm39) missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134,433,544 (GRCm39) missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134,389,893 (GRCm39) missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134,392,766 (GRCm39) missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134,412,776 (GRCm39) splice site probably benign
R7208:Gtf2ird1 UTSW 5 134,439,948 (GRCm39) missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134,433,758 (GRCm39) missense probably benign 0.01
R7517:Gtf2ird1 UTSW 5 134,391,379 (GRCm39) missense probably benign
R7786:Gtf2ird1 UTSW 5 134,419,753 (GRCm39) nonsense probably null
R7788:Gtf2ird1 UTSW 5 134,445,985 (GRCm39) nonsense probably null
R7850:Gtf2ird1 UTSW 5 134,392,069 (GRCm39) missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134,392,063 (GRCm39) missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134,386,689 (GRCm39) missense unknown
R8712:Gtf2ird1 UTSW 5 134,444,064 (GRCm39) missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134,389,879 (GRCm39) nonsense probably null
R9473:Gtf2ird1 UTSW 5 134,433,534 (GRCm39) missense probably benign 0.08
R9669:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
R9737:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
X0026:Gtf2ird1 UTSW 5 134,404,956 (GRCm39) splice site probably null
Z1176:Gtf2ird1 UTSW 5 134,438,166 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTTCCTTGGCTAGCCTGGAAC -3'
(R):5'- CAGACACAGCAGGACTTTCATTC -3'

Sequencing Primer
(F):5'- TGGAACACCCAGCCCAG -3'
(R):5'- CTGCCTGCCGACTACATGTG -3'
Posted On 2015-10-08