Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Cpvl'

351915

Institutional Source

Beutler Lab

Gene Symbol

Cpvl

Ensembl Gene

ENSMUSG00000052955

Gene Name

carboxypeptidase, vitellogenic-like

Synonyms

MMRRC Submission

041924-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53873279-53978671 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 53931933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 282 (E282K)

Ref Sequence

ENSEMBL: ENSMUSP00000144942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166545] [ENSMUST00000203101] [ENSMUST00000204674]

AlphaFold

Q9D3S9

Predicted Effect

probably benign
Transcript: ENSMUST00000166545
AA Change: E282K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000131462
Gene: ENSMUSG00000052955
AA Change: E282K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203101

SMART Domains

Protein: ENSMUSP00000145288
Gene: ENSMUSG00000052955

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	266	3.8e-68	PFAM
Pfam:Peptidase_S10	262	426	5.2e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204674
AA Change: E282K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000144942
Gene: ENSMUSG00000052955
AA Change: E282K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the serine carboxypeptidase family of proteases that cleave amino acids from the C-terminus of a protein substrate. The human ortholog of this gene, where it was first characterized, was found to be upregulated during the maturation of monocytes to macrophages. The encoded protein may be involved in antigen processing, digestion of phagocytosed proteins in the lysosome and lamellipodium formation. Disruption of this gene in mice was found to cause embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a transposon insertion allele die prior to birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Cpvl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Cpvl	APN	6	53974655	missense	possibly damaging	0.92
IGL01340:Cpvl	APN	6	53896451	nonsense	probably null
IGL02596:Cpvl	APN	6	53932010	missense	probably damaging	1.00
PIT4472001:Cpvl	UTSW	6	53896479	missense	possibly damaging	0.69
R0242:Cpvl	UTSW	6	53932500	missense	possibly damaging	0.95
R0242:Cpvl	UTSW	6	53932500	missense	possibly damaging	0.95
R1586:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R1987:Cpvl	UTSW	6	53954611	missense	probably benign	0.01
R4609:Cpvl	UTSW	6	53974620	critical splice donor site	probably null
R4664:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R4665:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R5863:Cpvl	UTSW	6	53873428	missense	probably damaging	0.99
R5909:Cpvl	UTSW	6	53932428	missense	probably damaging	0.98
R6163:Cpvl	UTSW	6	53873518	missense	probably damaging	1.00
R6948:Cpvl	UTSW	6	53896483	missense	possibly damaging	0.94
R7023:Cpvl	UTSW	6	53967812	missense	probably benign	0.00
R7262:Cpvl	UTSW	6	53932515	missense	probably damaging	1.00
R7330:Cpvl	UTSW	6	53974759	missense	probably benign	0.43
R7488:Cpvl	UTSW	6	53947742	missense	probably damaging	1.00
R7694:Cpvl	UTSW	6	53932517	nonsense	probably null
R7728:Cpvl	UTSW	6	53925290	missense	probably benign	0.00
R7750:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R7768:Cpvl	UTSW	6	53896491	missense	possibly damaging	0.91
R7773:Cpvl	UTSW	6	53931905	critical splice donor site	probably null
R7868:Cpvl	UTSW	6	53974760	missense	possibly damaging	0.64
R8670:Cpvl	UTSW	6	53974795	start codon destroyed	probably null	0.69
R9228:Cpvl	UTSW	6	53974794	start codon destroyed	probably null	0.00
R9337:Cpvl	UTSW	6	53932494	missense	probably damaging	1.00
X0062:Cpvl	UTSW	6	53926852	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACAGCCTAAGTGAACTCAGAGG -3'
(R):5'- GGTCAATTGTTTCTTCTTGAAGCC -3'

Sequencing Primer
(F):5'- CTAAGTGAACTCAGAGGCGTGC -3'
(R):5'- CAAGGGCGCCCAACCTTC -3'

Posted On

2015-10-08