Incidental Mutation 'R4666:Cntn6'
ID 351916
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 104469751-104840367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104705245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 154 (E154G)
Ref Sequence ENSEMBL: ENSMUSP00000124714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably benign
Transcript: ENSMUST00000089215
AA Change: E226G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: E226G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161070
AA Change: E154G

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: E154G

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162872
AA Change: E226G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: E226G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Meta Mutation Damage Score 0.0963 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104,627,361 (GRCm39) missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104,751,484 (GRCm39) missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104,705,335 (GRCm39) splice site probably benign
IGL02028:Cntn6 APN 6 104,836,387 (GRCm39) missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104,823,103 (GRCm39) critical splice donor site probably null
IGL02557:Cntn6 APN 6 104,751,496 (GRCm39) missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104,781,347 (GRCm39) missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104,781,299 (GRCm39) missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104,753,418 (GRCm39) splice site probably benign
PIT4366001:Cntn6 UTSW 6 104,809,498 (GRCm39) missense probably benign 0.05
R0490:Cntn6 UTSW 6 104,810,879 (GRCm39) missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104,753,275 (GRCm39) missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104,840,109 (GRCm39) missense probably benign 0.00
R0654:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R0960:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R1241:Cntn6 UTSW 6 104,809,470 (GRCm39) missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104,838,861 (GRCm39) missense probably benign 0.07
R1401:Cntn6 UTSW 6 104,781,359 (GRCm39) missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R1542:Cntn6 UTSW 6 104,825,061 (GRCm39) missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104,809,541 (GRCm39) missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104,838,783 (GRCm39) nonsense probably null
R2097:Cntn6 UTSW 6 104,838,910 (GRCm39) missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104,545,989 (GRCm39) start gained probably benign
R2429:Cntn6 UTSW 6 104,627,526 (GRCm39) missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104,703,198 (GRCm39) missense probably benign 0.04
R4009:Cntn6 UTSW 6 104,810,783 (GRCm39) missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104,749,522 (GRCm39) missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4701:Cntn6 UTSW 6 104,781,321 (GRCm39) missense probably benign 0.01
R4780:Cntn6 UTSW 6 104,822,745 (GRCm39) missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104,836,436 (GRCm39) missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104,751,435 (GRCm39) missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104,749,558 (GRCm39) missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104,809,991 (GRCm39) missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104,546,074 (GRCm39) intron probably benign
R5291:Cntn6 UTSW 6 104,703,096 (GRCm39) missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104,809,523 (GRCm39) missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104,812,706 (GRCm39) missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104,810,064 (GRCm39) missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104,744,851 (GRCm39) missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104,703,100 (GRCm39) missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104,627,461 (GRCm39) missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104,836,409 (GRCm39) missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104,838,907 (GRCm39) missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104,822,719 (GRCm39) frame shift probably null
R7012:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R7012:Cntn6 UTSW 6 104,703,223 (GRCm39) missense probably damaging 0.98
R7337:Cntn6 UTSW 6 104,627,491 (GRCm39) missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104,627,444 (GRCm39) missense probably benign 0.29
R8133:Cntn6 UTSW 6 104,705,298 (GRCm39) missense probably benign 0.19
R8463:Cntn6 UTSW 6 104,749,580 (GRCm39) missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably benign 0.05
R9232:Cntn6 UTSW 6 104,815,781 (GRCm39) missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104,809,471 (GRCm39) missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104,781,308 (GRCm39) missense possibly damaging 0.82
R9698:Cntn6 UTSW 6 104,810,044 (GRCm39) nonsense probably null
X0020:Cntn6 UTSW 6 104,744,845 (GRCm39) missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104,809,545 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATGAGAGTTCCATAAAATGAGGG -3'
(R):5'- TGCCCCGCACTTGAAATCTG -3'

Sequencing Primer
(F):5'- GAATGTCACTAGTGAAGGATCTTTG -3'
(R):5'- GCCCCGCACTTGAAATCTGTTTAG -3'
Posted On 2015-10-08