Incidental Mutation 'R4666:Foxa3'
ID 351920
Institutional Source Beutler Lab
Gene Symbol Foxa3
Ensembl Gene ENSMUSG00000040891
Gene Name forkhead box A3
Synonyms Tcf-3g, Hnf3g, Tcf3g, Hnf-3g
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 18747209-18757463 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 18748297 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 275 (C275*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036018]
AlphaFold P35584
Predicted Effect probably null
Transcript: ENSMUST00000036018
AA Change: C276*
SMART Domains Protein: ENSMUSP00000043173
Gene: ENSMUSG00000040891
AA Change: C276*

DomainStartEndE-ValueType
low complexity region 59 93 N/A INTRINSIC
FH 117 207 5.48e-62 SMART
low complexity region 226 267 N/A INTRINSIC
Pfam:HNF_C 304 332 1.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153321
AA Change: C275*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific transcripts such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. The crystal structure of a similar protein in rat has been resolved. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expression of several liver-specific and liver-enriched genes, but appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Foxa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Foxa3 APN 7 18,748,443 (GRCm39) missense probably benign
R0378:Foxa3 UTSW 7 18,757,294 (GRCm39) missense probably damaging 1.00
R1833:Foxa3 UTSW 7 18,748,499 (GRCm39) missense probably damaging 1.00
R2159:Foxa3 UTSW 7 18,748,109 (GRCm39) missense probably benign 0.40
R2877:Foxa3 UTSW 7 18,748,805 (GRCm39) missense probably benign 0.38
R5533:Foxa3 UTSW 7 18,748,940 (GRCm39) nonsense probably null
R5669:Foxa3 UTSW 7 18,748,176 (GRCm39) missense probably benign 0.41
R7339:Foxa3 UTSW 7 18,748,794 (GRCm39) missense probably damaging 1.00
R8128:Foxa3 UTSW 7 18,757,341 (GRCm39) start codon destroyed probably null 0.77
R8329:Foxa3 UTSW 7 18,748,109 (GRCm39) missense probably benign 0.40
R9232:Foxa3 UTSW 7 18,748,790 (GRCm39) missense probably damaging 1.00
R9305:Foxa3 UTSW 7 18,748,961 (GRCm39) missense possibly damaging 0.82
R9627:Foxa3 UTSW 7 18,748,458 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTAGTAGACTCCAGGCTC -3'
(R):5'- TGAGAACGGCTGCTATCTCC -3'

Sequencing Primer
(F):5'- TAGTAGACTCCAGGCTCCCCAC -3'
(R):5'- GCAGAAGCGCTTCAAGCTG -3'
Posted On 2015-10-08