Incidental Mutation 'R4666:Trpm1'
ID 351924
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 041924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 64153835-64269775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 64203034 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 65 (L65F)
Ref Sequence ENSEMBL: ENSMUSP00000146265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205690] [ENSMUST00000206277] [ENSMUST00000206706] [ENSMUST00000206263] [ENSMUST00000205731] [ENSMUST00000206049] [ENSMUST00000206107] [ENSMUST00000206314]
AlphaFold Q2TV84
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083651
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: L198F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: L198F

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107515
AA Change: L65F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103139
Gene: ENSMUSG00000030523
AA Change: L65F

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 323 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107516
AA Change: *198L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141574
AA Change: L254F
Predicted Effect probably damaging
Transcript: ENSMUST00000177102
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: L82F

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000205348
AA Change: L198F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect probably benign
Transcript: ENSMUST00000205684
Predicted Effect probably benign
Transcript: ENSMUST00000205690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205728
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: L198F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206706
AA Change: L65F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205731
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206453
Predicted Effect probably benign
Transcript: ENSMUST00000206049
Predicted Effect probably benign
Transcript: ENSMUST00000206107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205960
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 64268561 missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 64199250 intron probably benign
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 splice site probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 64240535 missense probably damaging 1.00
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
R7025:Trpm1 UTSW 7 64226714 critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 64235845 missense probably damaging 0.97
R7168:Trpm1 UTSW 7 64268697 missense probably benign 0.01
R7219:Trpm1 UTSW 7 64204585 missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 64219106 critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 64209981 nonsense probably null
R7367:Trpm1 UTSW 7 64268801 missense probably benign 0.06
R7449:Trpm1 UTSW 7 64208975 missense probably benign 0.14
R7466:Trpm1 UTSW 7 64240582 missense probably damaging 0.99
R7498:Trpm1 UTSW 7 64208909 missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 64204555 missense probably benign 0.00
R7776:Trpm1 UTSW 7 64248191 missense probably benign 0.04
R8062:Trpm1 UTSW 7 64201941 missense probably benign 0.18
R8069:Trpm1 UTSW 7 64208970 missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 64199269 missense probably damaging 1.00
R8219:Trpm1 UTSW 7 64201951 missense probably benign 0.35
R8258:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8259:Trpm1 UTSW 7 64269029 missense probably benign 0.10
R8320:Trpm1 UTSW 7 64268793 missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 64247407 missense probably damaging 1.00
R8544:Trpm1 UTSW 7 64224608 splice site probably null
R8813:Trpm1 UTSW 7 64202008 missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 64268880 missense probably benign 0.06
R8954:Trpm1 UTSW 7 64208341 missense probably damaging 0.98
R9139:Trpm1 UTSW 7 64199195 missense probably benign 0.00
R9205:Trpm1 UTSW 7 64240571 missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 64234965 missense probably benign 0.01
R9283:Trpm1 UTSW 7 64223875 missense probably benign 0.18
R9394:Trpm1 UTSW 7 64268732 missense probably benign 0.00
R9430:Trpm1 UTSW 7 64223698 missense probably benign 0.38
R9537:Trpm1 UTSW 7 64153868 unclassified probably benign
R9616:Trpm1 UTSW 7 64208384 missense probably damaging 0.99
R9774:Trpm1 UTSW 7 64248293 missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Z1176:Trpm1 UTSW 7 64203131 critical splice donor site probably null
Z1176:Trpm1 UTSW 7 64204594 critical splice donor site probably null
Z1177:Trpm1 UTSW 7 64217691 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGATCAATGGTTGTGATGAGC -3'
(R):5'- GCCATAGCAATCTGAGTGTCC -3'

Sequencing Primer
(F):5'- ACAGACTTGTGGGATGTATTCTC -3'
(R):5'- ATCTTGATGGCAGCAATGTCAGC -3'
Posted On 2015-10-08