Incidental Mutation 'R4666:Pik3r2'
ID 351930
Institutional Source Beutler Lab
Gene Symbol Pik3r2
Ensembl Gene ENSMUSG00000031834
Gene Name phosphoinositide-3-kinase regulatory subunit 2
Synonyms p85beta
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 70768176-70776713 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70768859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 667 (T667I)
Ref Sequence ENSEMBL: ENSMUSP00000034296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000143785]
AlphaFold O08908
PDB Structure CRYSTAL STRUCTURE OF P110BETA IN COMPLEX WITH ICSH2 OF P85BETA AND THE DRUG GDC-0941 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034296
AA Change: T667I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834
AA Change: T667I

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034299
SMART Domains Protein: ENSMUSP00000034299
Gene: ENSMUSG00000031838

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:GILT 60 163 4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143785
SMART Domains Protein: ENSMUSP00000122065
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
Blast:RhoGAP 1 30 1e-8 BLAST
Pfam:SH2 33 70 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152545
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222087
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have lower blood glucose levels both when fed and after fasting. Insulin sensitivity is improved as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 (GRCm38) S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 (GRCm38) T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 (GRCm38) M142V probably damaging Het
Abce1 A G 8: 79,687,486 (GRCm38) V532A probably damaging Het
Adamts12 T A 15: 11,311,492 (GRCm38) N1278K probably benign Het
Adipor1 T A 1: 134,424,905 (GRCm38) I138N probably damaging Het
Aox2 C T 1: 58,304,597 (GRCm38) Q480* probably null Het
Arhgef38 C T 3: 133,140,772 (GRCm38) probably null Het
Atmin A G 8: 116,957,959 (GRCm38) D786G probably damaging Het
Capn1 A T 19: 6,011,015 (GRCm38) N253K probably benign Het
Cdh8 T C 8: 99,024,902 (GRCm38) T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 (GRCm38) S1093P probably damaging Het
Cep135 C A 5: 76,616,854 (GRCm38) P560T probably benign Het
Chfr C T 5: 110,144,867 (GRCm38) Q167* probably null Het
Chrna4 A G 2: 181,037,493 (GRCm38) S54P probably damaging Het
Cntln A G 4: 84,971,216 (GRCm38) N312S probably benign Het
Cntn6 A G 6: 104,728,284 (GRCm38) E154G probably benign Het
Col6a6 T A 9: 105,767,342 (GRCm38) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 (GRCm38) S61P probably damaging Het
Cpvl C T 6: 53,931,933 (GRCm38) E282K probably benign Het
Cryba2 C T 1: 74,890,048 (GRCm38) D179N probably benign Het
Daglb A T 5: 143,503,349 (GRCm38) R654W probably damaging Het
Dennd3 A G 15: 73,570,860 (GRCm38) D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 (GRCm38) E405G probably damaging Het
Dnah10 T C 5: 124,828,472 (GRCm38) M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 (GRCm38) S238P probably damaging Het
Duox1 C T 2: 122,319,475 (GRCm38) P116S probably benign Het
Ebf1 A G 11: 44,991,557 (GRCm38) N447D probably damaging Het
Epg5 A G 18: 78,012,864 (GRCm38) N1751S probably benign Het
Exoc6 A G 19: 37,570,505 (GRCm38) D75G probably damaging Het
Extl2 T A 3: 116,024,207 (GRCm38) I70N probably damaging Het
Fam129c G T 8: 71,603,825 (GRCm38) E390* probably null Het
Fanca T C 8: 123,268,972 (GRCm38) T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 (GRCm38) probably null Het
Foxa3 G T 7: 19,014,372 (GRCm38) C275* probably null Het
Foxred1 C T 9: 35,210,855 (GRCm38) probably benign Het
Galr2 A G 11: 116,283,629 (GRCm38) T362A probably benign Het
Garem2 C A 5: 30,114,667 (GRCm38) R376S probably damaging Het
Gatc T A 5: 115,335,547 (GRCm38) N111I probably benign Het
Gjb4 C A 4: 127,351,778 (GRCm38) K123N probably damaging Het
Gm14025 T C 2: 129,038,230 (GRCm38) H592R probably benign Het
Gm9894 T C 13: 67,765,094 (GRCm38) noncoding transcript Het
Gtdc1 T C 2: 44,591,925 (GRCm38) N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 (GRCm38) E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 (GRCm38) I96V probably benign Het
Homer1 T A 13: 93,402,159 (GRCm38) I170N probably damaging Het
Homer3 G A 8: 70,290,143 (GRCm38) probably null Het
Hoxb9 A G 11: 96,274,831 (GRCm38) K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 (GRCm38) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 (GRCm38) probably benign Het
Lsm11 A G 11: 45,933,813 (GRCm38) S296P probably damaging Het
Macrod2 T C 2: 142,217,599 (GRCm38) L265P probably damaging Het
Mcu G A 10: 59,456,699 (GRCm38) L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 (GRCm38) V104A possibly damaging Het
Myh10 G A 11: 68,801,730 (GRCm38) probably null Het
Nemf T C 12: 69,312,280 (GRCm38) E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 (GRCm38) S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 (GRCm38) I82F probably benign Het
Nlrp4e T A 7: 23,336,780 (GRCm38) L686* probably null Het
Nudt12os T A 17: 59,024,551 (GRCm38) noncoding transcript Het
Olfr1122 T A 2: 87,387,876 (GRCm38) I57K probably damaging Het
Olfr16 G A 1: 172,957,590 (GRCm38) S265N probably benign Het
Olfr180 T C 16: 58,916,584 (GRCm38) D19G probably benign Het
Olfr205 A G 16: 59,329,210 (GRCm38) Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 (GRCm38) S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 (GRCm38) M163K probably damaging Het
Pde7a T C 3: 19,260,256 (GRCm38) T59A probably damaging Het
Pde7b A C 10: 20,438,750 (GRCm38) D203E probably damaging Het
Phkg2 T A 7: 127,577,984 (GRCm38) I94N possibly damaging Het
Pitx3 T A 19: 46,137,101 (GRCm38) H68L possibly damaging Het
Prcd A G 11: 116,668,164 (GRCm38) probably benign Het
Prune2 C T 19: 17,120,188 (GRCm38) R1019* probably null Het
Psap A G 10: 60,300,545 (GRCm38) D486G probably benign Het
Purb A T 11: 6,475,615 (GRCm38) V91E probably damaging Het
Recql C A 6: 142,376,841 (GRCm38) V112F probably damaging Het
Rptor A T 11: 119,743,882 (GRCm38) I175F probably damaging Het
Sbf1 C T 15: 89,295,246 (GRCm38) V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 (GRCm38) S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 (GRCm38) L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 (GRCm38) N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 (GRCm38) M1294K probably damaging Het
Sp6 C A 11: 97,021,875 (GRCm38) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm38) probably benign Het
Spon1 T A 7: 114,028,969 (GRCm38) M320K probably benign Het
Tceanc2 A T 4: 107,165,560 (GRCm38) S77T probably damaging Het
Thsd7a T A 6: 12,504,013 (GRCm38) I381F possibly damaging Het
Thsd7a T A 6: 12,337,314 (GRCm38) T1235S possibly damaging Het
Tmc4 T C 7: 3,671,271 (GRCm38) probably null Het
Tmprss11d T C 5: 86,309,401 (GRCm38) D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 (GRCm38) V65D probably damaging Het
Trpm1 G T 7: 64,203,034 (GRCm38) L65F probably damaging Het
Tyk2 C T 9: 21,114,207 (GRCm38) A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 (GRCm38) Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 (GRCm38) S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 (GRCm38) W1222L possibly damaging Het
Vcan C A 13: 89,679,934 (GRCm38) W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 (GRCm38) N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 (GRCm38) D469G probably benign Het
Vps13b A G 15: 35,640,544 (GRCm38) S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 (GRCm38) R216H probably damaging Het
Other mutations in Pik3r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Pik3r2 APN 8 70,770,429 (GRCm38) missense probably damaging 1.00
IGL01637:Pik3r2 APN 8 70,772,348 (GRCm38) unclassified probably benign
IGL02514:Pik3r2 APN 8 70,770,592 (GRCm38) missense probably benign 0.00
IGL03395:Pik3r2 APN 8 70,772,355 (GRCm38) missense probably benign
kingfisher UTSW 8 70,770,901 (GRCm38) missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70,770,901 (GRCm38) missense probably damaging 1.00
R0022:Pik3r2 UTSW 8 70,770,901 (GRCm38) missense probably damaging 1.00
R0448:Pik3r2 UTSW 8 70,772,044 (GRCm38) unclassified probably benign
R1636:Pik3r2 UTSW 8 70,771,898 (GRCm38) missense probably benign
R1662:Pik3r2 UTSW 8 70,770,606 (GRCm38) missense probably damaging 1.00
R2114:Pik3r2 UTSW 8 70,769,385 (GRCm38) missense probably benign 0.31
R2879:Pik3r2 UTSW 8 70,772,385 (GRCm38) missense probably benign
R3830:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R3852:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R3859:Pik3r2 UTSW 8 70,769,986 (GRCm38) missense probably damaging 1.00
R3967:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R3968:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R3969:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R3970:Pik3r2 UTSW 8 70,770,421 (GRCm38) missense probably benign 0.19
R4606:Pik3r2 UTSW 8 70,772,136 (GRCm38) nonsense probably null
R5481:Pik3r2 UTSW 8 70,769,764 (GRCm38) missense probably benign 0.31
R6445:Pik3r2 UTSW 8 70,772,026 (GRCm38) missense probably benign 0.01
R6578:Pik3r2 UTSW 8 70,772,639 (GRCm38) missense probably benign 0.00
R6667:Pik3r2 UTSW 8 70,769,173 (GRCm38) missense probably damaging 1.00
R6794:Pik3r2 UTSW 8 70,770,717 (GRCm38) missense probably benign 0.43
R6863:Pik3r2 UTSW 8 70,770,414 (GRCm38) missense probably damaging 1.00
R7378:Pik3r2 UTSW 8 70,769,381 (GRCm38) missense probably benign 0.03
R7750:Pik3r2 UTSW 8 70,770,901 (GRCm38) missense probably damaging 1.00
R7821:Pik3r2 UTSW 8 70,769,764 (GRCm38) missense probably damaging 1.00
R8056:Pik3r2 UTSW 8 70,772,367 (GRCm38) missense probably benign 0.14
R8237:Pik3r2 UTSW 8 70,772,150 (GRCm38) missense probably benign 0.00
R8414:Pik3r2 UTSW 8 70,770,435 (GRCm38) missense probably damaging 1.00
R8534:Pik3r2 UTSW 8 70,774,668 (GRCm38) missense probably benign
R8781:Pik3r2 UTSW 8 70,769,402 (GRCm38) missense possibly damaging 0.88
R8794:Pik3r2 UTSW 8 70,771,363 (GRCm38) missense probably benign
R9322:Pik3r2 UTSW 8 70,774,850 (GRCm38) missense possibly damaging 0.74
R9401:Pik3r2 UTSW 8 70,771,093 (GRCm38) missense possibly damaging 0.77
R9668:Pik3r2 UTSW 8 70,768,815 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTAAACATGGCAGGCG -3'
(R):5'- AGTCATTTGTGTTGCGAATCC -3'

Sequencing Primer
(F):5'- TTCACCAGGGGAGGGGATC -3'
(R):5'- CGAATCCATTGTGTGCATTGAGC -3'
Posted On 2015-10-08