Incidental Mutation 'R4666:Cdh8'
Institutional Source Beutler Lab
Gene Symbol Cdh8
Ensembl Gene ENSMUSG00000036510
Gene Namecadherin 8
MMRRC Submission 041924-MU
Accession Numbers

Ncbi RefSeq: NM_001039154.1, NM_007667.2; MGI:107434

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4666 (G1)
Quality Score225
Status Not validated
Chromosomal Location99024471-99416471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99024902 bp
Amino Acid Change Threonine to Alanine at position 728 (T728A)
Ref Sequence ENSEMBL: ENSMUSP00000123619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093249] [ENSMUST00000128860] [ENSMUST00000142129] [ENSMUST00000145601] [ENSMUST00000155527]
Predicted Effect probably benign
Transcript: ENSMUST00000093249
SMART Domains Protein: ENSMUSP00000090935
Gene: ENSMUSG00000036510

low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 712 1.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128860
SMART Domains Protein: ENSMUSP00000117326
Gene: ENSMUSG00000036510

low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 647 792 7e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142129
SMART Domains Protein: ENSMUSP00000114507
Gene: ENSMUSG00000036510

low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 702 5.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145601
SMART Domains Protein: ENSMUSP00000122493
Gene: ENSMUSG00000036510

low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 502 1.27e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155527
AA Change: T728A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123619
Gene: ENSMUSG00000036510
AA Change: T728A

low complexity region 12 24 N/A INTRINSIC
CA 84 165 9.52e-17 SMART
CA 189 274 7.14e-30 SMART
CA 298 390 8.16e-16 SMART
CA 413 494 6.14e-20 SMART
CA 517 604 1.16e-11 SMART
transmembrane domain 622 644 N/A INTRINSIC
Pfam:Cadherin_C 645 745 1.8e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161244
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype Strain: 3707077
FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit reduced behavioral responses to cold, but not thermal stimuli. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal but display abnormal CNS synaptic transmission, raise their tails in response to stress, and show reduced sensitivity to cutaneous cold stimuli. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Cdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cdh8 APN 8 99279690 missense probably damaging 0.99
IGL01377:Cdh8 APN 8 99033389 missense probably damaging 0.99
IGL01845:Cdh8 APN 8 99098954 splice site probably benign
IGL02166:Cdh8 APN 8 99190451 missense probably damaging 1.00
IGL02392:Cdh8 APN 8 99030755 missense probably damaging 0.96
R0007:Cdh8 UTSW 8 99230456 nonsense probably null
R0179:Cdh8 UTSW 8 99111712 missense possibly damaging 0.84
R0196:Cdh8 UTSW 8 99190434 missense probably damaging 0.99
R0220:Cdh8 UTSW 8 99111679 missense probably benign 0.21
R0271:Cdh8 UTSW 8 99111715 missense possibly damaging 0.83
R0592:Cdh8 UTSW 8 99279478 missense probably damaging 1.00
R0612:Cdh8 UTSW 8 99400914 missense probably benign 0.02
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1404:Cdh8 UTSW 8 99279618 missense probably damaging 1.00
R1588:Cdh8 UTSW 8 99190407 missense probably damaging 1.00
R1635:Cdh8 UTSW 8 99031024 missense probably damaging 1.00
R1717:Cdh8 UTSW 8 99030705 missense probably damaging 1.00
R1781:Cdh8 UTSW 8 99190462 splice site probably null
R1781:Cdh8 UTSW 8 99279658 missense probably damaging 0.98
R1862:Cdh8 UTSW 8 99190394 missense probably damaging 1.00
R1895:Cdh8 UTSW 8 99279557 missense possibly damaging 0.84
R1912:Cdh8 UTSW 8 99098870 missense probably damaging 1.00
R2005:Cdh8 UTSW 8 99033471 splice site probably null
R2142:Cdh8 UTSW 8 99111693 missense probably damaging 1.00
R2197:Cdh8 UTSW 8 99196265 missense probably damaging 1.00
R2512:Cdh8 UTSW 8 99400863 missense probably benign 0.05
R3085:Cdh8 UTSW 8 99196386 missense probably benign 0.00
R3436:Cdh8 UTSW 8 99400718 splice site probably benign
R3898:Cdh8 UTSW 8 99171373 missense probably damaging 0.98
R4470:Cdh8 UTSW 8 99416689 unclassified probably benign
R4615:Cdh8 UTSW 8 99279622 missense probably damaging 1.00
R4652:Cdh8 UTSW 8 99024859 missense probably benign
R4798:Cdh8 UTSW 8 99024926 nonsense probably null
R4871:Cdh8 UTSW 8 99030904 missense probably damaging 1.00
R5170:Cdh8 UTSW 8 99279550 missense probably damaging 1.00
R5406:Cdh8 UTSW 8 99196370 missense probably damaging 1.00
R5564:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R5686:Cdh8 UTSW 8 99033222 missense probably benign 0.00
R6311:Cdh8 UTSW 8 99400895 missense probably damaging 0.99
R6786:Cdh8 UTSW 8 99223947 missense probably benign 0.19
R6855:Cdh8 UTSW 8 99190217 missense probably damaging 0.99
R6950:Cdh8 UTSW 8 99030763 missense probably benign 0.18
R7112:Cdh8 UTSW 8 99196352 missense probably damaging 1.00
R7181:Cdh8 UTSW 8 99098925 missense probably benign
R7384:Cdh8 UTSW 8 99230506 missense probably benign
R7400:Cdh8 UTSW 8 99279560 missense probably damaging 1.00
R7537:Cdh8 UTSW 8 99098885 nonsense probably null
R7763:Cdh8 UTSW 8 99279674 nonsense probably null
R8130:Cdh8 UTSW 8 99031044 missense probably damaging 0.98
R8215:Cdh8 UTSW 8 99030866 missense possibly damaging 0.57
R8314:Cdh8 UTSW 8 99171379 missense probably damaging 1.00
R8443:Cdh8 UTSW 8 99031040 missense possibly damaging 0.56
X0022:Cdh8 UTSW 8 99279475 missense probably damaging 1.00
Z1088:Cdh8 UTSW 8 99279502 missense probably damaging 1.00
Z1176:Cdh8 UTSW 8 99171323 missense probably benign 0.02
Z1176:Cdh8 UTSW 8 99190205 missense probably null 0.89
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08