Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Fanca'

351935

Institutional Source

Beutler Lab

Gene Symbol

Fanca

Ensembl Gene

ENSMUSG00000032815

Gene Name

Fanconi anemia, complementation group A

Synonyms

MMRRC Submission

041924-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.699) question?

Stock #

R4666 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

123268300-123318576 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123268972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1364 (T1364A)

Ref Sequence

ENSEMBL: ENSMUSP00000045217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000154450]

AlphaFold

Q9JL70

Predicted Effect

probably benign
Transcript: ENSMUST00000001092

SMART Domains

Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065

Domain	Start	End	E-Value	Type
low complexity region	18	41	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:zf-AD	79	159	1.2e-13	PFAM
low complexity region	402	422	N/A	INTRINSIC
ZnF_C2H2	434	458	2.24e-3	SMART
ZnF_C2H2	465	490	6.67e-2	SMART
ZnF_C2H2	496	518	1.38e-3	SMART
ZnF_C2H2	524	546	1.82e-3	SMART
ZnF_C2H2	554	577	4.79e-3	SMART
low complexity region	586	602	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000035495
AA Change: T1364A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815
AA Change: T1364A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC
Pfam:Fanconi_A_N	167	520	3.7e-146	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	1069	1079	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
Pfam:Fanconi_A	1246	1308	8.4e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126834

SMART Domains

Protein: ENSMUSP00000116732
Gene: ENSMUSG00000032815

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
low complexity region	142	167	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130333

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135702

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147312

Predicted Effect

probably benign
Transcript: ENSMUST00000154450

SMART Domains

Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

Domain	Start	End	E-Value	Type
low complexity region	18	41	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:zf-AD	79	159	1.9e-14	PFAM
low complexity region	183	203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156896

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211934

Predicted Effect

unknown
Transcript: ENSMUST00000213090
AA Change: T93A

Meta Mutation Damage Score

0.1057

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Fanca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02348:Fanca	APN	8	123305263	missense	probably damaging	1.00
IGL02805:Fanca	APN	8	123289494	missense	probably damaging	0.99
IGL03280:Fanca	APN	8	123316459	unclassified	probably benign
PIT4402001:Fanca	UTSW	8	123313064	missense	possibly damaging	0.83
R0114:Fanca	UTSW	8	123288491	splice site	probably null
R0115:Fanca	UTSW	8	123268539	missense	probably benign	0.00
R0271:Fanca	UTSW	8	123272441	unclassified	probably benign
R0330:Fanca	UTSW	8	123274172	nonsense	probably null
R0345:Fanca	UTSW	8	123304813	missense	probably damaging	1.00
R0570:Fanca	UTSW	8	123306430	missense	probably benign	0.01
R0601:Fanca	UTSW	8	123308513	missense	probably damaging	0.99
R0617:Fanca	UTSW	8	123288070	missense	probably damaging	0.99
R0639:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R0943:Fanca	UTSW	8	123274186	missense	probably damaging	1.00
R1140:Fanca	UTSW	8	123313129	splice site	probably null
R1364:Fanca	UTSW	8	123304281	splice site	probably benign
R1366:Fanca	UTSW	8	123304281	splice site	probably benign
R1367:Fanca	UTSW	8	123304281	splice site	probably benign
R1368:Fanca	UTSW	8	123304281	splice site	probably benign
R1969:Fanca	UTSW	8	123288064	missense	probably benign	0.41
R1992:Fanca	UTSW	8	123297812	missense	possibly damaging	0.94
R2060:Fanca	UTSW	8	123274481	missense	probably damaging	1.00
R2174:Fanca	UTSW	8	123271270	missense	probably benign	0.00
R2261:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R3957:Fanca	UTSW	8	123316363	missense	probably benign	0.00
R4062:Fanca	UTSW	8	123275172	missense	probably benign	0.00
R4153:Fanca	UTSW	8	123304878	missense	possibly damaging	0.89
R4270:Fanca	UTSW	8	123268794	missense	probably damaging	1.00
R4424:Fanca	UTSW	8	123288793	missense	probably benign	0.11
R4581:Fanca	UTSW	8	123274338	splice site	probably null
R4639:Fanca	UTSW	8	123318150	missense	probably damaging	0.98
R4664:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4665:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4686:Fanca	UTSW	8	123268934	splice site	probably benign
R4775:Fanca	UTSW	8	123296306	missense	probably damaging	0.99
R4782:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4799:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4926:Fanca	UTSW	8	123303985	missense	probably benign	0.05
R4973:Fanca	UTSW	8	123308522	missense	probably damaging	0.96
R5039:Fanca	UTSW	8	123284046	missense	probably benign
R5195:Fanca	UTSW	8	123303945	intron	probably benign
R5590:Fanca	UTSW	8	123303963	intron	probably benign
R5848:Fanca	UTSW	8	123295053	intron	probably benign
R5965:Fanca	UTSW	8	123316410	missense	possibly damaging	0.46
R6224:Fanca	UTSW	8	123305281	missense	possibly damaging	0.87
R6385:Fanca	UTSW	8	123305867	splice site	probably null
R6762:Fanca	UTSW	8	123271303	missense	probably benign	0.26
R6795:Fanca	UTSW	8	123318493	missense	probably benign	0.02
R6810:Fanca	UTSW	8	123286477	missense	probably damaging	0.99
R7153:Fanca	UTSW	8	123316425	missense	probably damaging	1.00
R7170:Fanca	UTSW	8	123271206	missense	probably damaging	1.00
R7204:Fanca	UTSW	8	123286477	missense	probably damaging	0.98
R7366:Fanca	UTSW	8	123281213	missense	probably benign	0.08
R7599:Fanca	UTSW	8	123271260	missense	probably benign
R7639:Fanca	UTSW	8	123291395	critical splice donor site	probably null
R7650:Fanca	UTSW	8	123268564	splice site	probably null
R8066:Fanca	UTSW	8	123303940	missense	unknown
R8247:Fanca	UTSW	8	123283955	unclassified	probably benign
R8312:Fanca	UTSW	8	123269810	intron	probably benign
R8327:Fanca	UTSW	8	123313245	nonsense	probably null
R8719:Fanca	UTSW	8	123288128	missense	probably benign	0.00
R8826:Fanca	UTSW	8	123268470	missense	probably benign	0.07
R8987:Fanca	UTSW	8	123297799	missense	probably damaging	1.00
R9017:Fanca	UTSW	8	123308568	missense	possibly damaging	0.69
R9319:Fanca	UTSW	8	123291451	missense	probably benign
R9471:Fanca	UTSW	8	123274158	missense	possibly damaging	0.88
R9542:Fanca	UTSW	8	123296339	missense	probably damaging	0.98
R9656:Fanca	UTSW	8	123304743	missense	probably benign	0.02
R9708:Fanca	UTSW	8	123274524	nonsense	probably null
V7732:Fanca	UTSW	8	123304281	splice site	probably benign
X0025:Fanca	UTSW	8	123276548	intron	probably benign
X0062:Fanca	UTSW	8	123304852	missense	possibly damaging	0.95
Z1177:Fanca	UTSW	8	123312629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACTGTTTTGGGCACTGAGG -3'
(R):5'- ACAAATGTGTGTATAGTCGCTGG -3'

Sequencing Primer
(F):5'- CACTGAGGTATTAGCTGCAGC -3'
(R):5'- ATAGTCGCTGGGCTGGGC -3'

Posted On

2015-10-08