Incidental Mutation 'R4666:Sorl1'
ID 351939
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms 2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 041924-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock # R4666 (G1)
Quality Score 178
Status Not validated
Chromosome 9
Chromosomal Location 41964720-42124297 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42004051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1294 (M1294K)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: M1294K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: M1294K

signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.2658 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 36,978,902 S12L probably benign Het
4921507P07Rik G T 6: 50,595,828 T35K possibly damaging Het
4931406P16Rik T C 7: 34,284,773 M142V probably damaging Het
Abce1 A G 8: 79,687,486 V532A probably damaging Het
Adamts12 T A 15: 11,311,492 N1278K probably benign Het
Adipor1 T A 1: 134,424,905 I138N probably damaging Het
Aox2 C T 1: 58,304,597 Q480* probably null Het
Arhgef38 C T 3: 133,140,772 probably null Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Cdh8 T C 8: 99,024,902 T728A possibly damaging Het
Celsr1 A G 15: 86,030,494 S1093P probably damaging Het
Cep135 C A 5: 76,616,854 P560T probably benign Het
Chfr C T 5: 110,144,867 Q167* probably null Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cntln A G 4: 84,971,216 N312S probably benign Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col6a6 T A 9: 105,767,342 Y1249F possibly damaging Het
Cpsf2 T C 12: 101,983,207 S61P probably damaging Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cryba2 C T 1: 74,890,048 D179N probably benign Het
Daglb A T 5: 143,503,349 R654W probably damaging Het
Dennd3 A G 15: 73,570,860 D1244G probably damaging Het
Dhx57 T C 17: 80,274,961 E405G probably damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dph1 A G 11: 75,181,330 S238P probably damaging Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Ebf1 A G 11: 44,991,557 N447D probably damaging Het
Epg5 A G 18: 78,012,864 N1751S probably benign Het
Exoc6 A G 19: 37,570,505 D75G probably damaging Het
Extl2 T A 3: 116,024,207 I70N probably damaging Het
Fam129c G T 8: 71,603,825 E390* probably null Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fbln7 T A 2: 128,894,910 probably null Het
Foxa3 G T 7: 19,014,372 C275* probably null Het
Foxred1 C T 9: 35,210,855 probably benign Het
Galr2 A G 11: 116,283,629 T362A probably benign Het
Garem2 C A 5: 30,114,667 R376S probably damaging Het
Gatc T A 5: 115,335,547 N111I probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gm14025 T C 2: 129,038,230 H592R probably benign Het
Gm9894 T C 13: 67,765,094 noncoding transcript Het
Gtdc1 T C 2: 44,591,925 N301S probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtsf1 T C 15: 103,421,205 I96V probably benign Het
Homer1 T A 13: 93,402,159 I170N probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Hoxb9 A G 11: 96,274,831 K242R possibly damaging Het
Ifna14 T C 4: 88,571,336 R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,318,408 probably benign Het
Lsm11 A G 11: 45,933,813 S296P probably damaging Het
Macrod2 T C 2: 142,217,599 L265P probably damaging Het
Mcu G A 10: 59,456,699 L53F probably damaging Het
Mpv17l2 A G 8: 70,760,415 V104A possibly damaging Het
Myh10 G A 11: 68,801,730 probably null Het
Nemf T C 12: 69,312,280 E1031G probably damaging Het
Nhsl1 G A 10: 18,531,405 S1395N probably damaging Het
Nlrp2 T A 7: 5,319,189 I82F probably benign Het
Nlrp4e T A 7: 23,336,780 L686* probably null Het
Nudt12os T A 17: 59,024,551 noncoding transcript Het
Olfr1122 T A 2: 87,387,876 I57K probably damaging Het
Olfr16 G A 1: 172,957,590 S265N probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr205 A G 16: 59,329,210 Y100H possibly damaging Het
Olfr93 A T 17: 37,151,379 S44T possibly damaging Het
Olfr944 T A 9: 39,217,846 M163K probably damaging Het
Pde7a T C 3: 19,260,256 T59A probably damaging Het
Pde7b A C 10: 20,438,750 D203E probably damaging Het
Phkg2 T A 7: 127,577,984 I94N possibly damaging Het
Pik3r2 G A 8: 70,768,859 T667I possibly damaging Het
Pitx3 T A 19: 46,137,101 H68L possibly damaging Het
Prcd A G 11: 116,668,164 probably benign Het
Prune2 C T 19: 17,120,188 R1019* probably null Het
Psap A G 10: 60,300,545 D486G probably benign Het
Purb A T 11: 6,475,615 V91E probably damaging Het
Recql C A 6: 142,376,841 V112F probably damaging Het
Rptor A T 11: 119,743,882 I175F probably damaging Het
Sbf1 C T 15: 89,295,246 V1385M probably damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Slc35f6 T C 5: 30,655,613 L37P probably damaging Het
Slc6a3 T A 13: 73,538,581 N22K possibly damaging Het
Sp6 C A 11: 97,021,875 A138E probably benign Het
Spag8 G T 4: 43,653,408 probably benign Het
Spon1 T A 7: 114,028,969 M320K probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmprss11d T C 5: 86,309,401 D133G probably damaging Het
Trav13n-3 T A 14: 53,337,496 V65D probably damaging Het
Trpm1 G T 7: 64,203,034 L65F probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ube2v1 T A 2: 167,610,377 Y102F probably damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uhrf1bp1 G T 17: 27,893,503 W1222L possibly damaging Het
Vcan C A 13: 89,679,934 W2171L probably damaging Het
Vmn1r64 T C 7: 5,884,358 N62S probably damaging Het
Vmn2r67 T C 7: 85,150,623 D469G probably benign Het
Vps13b A G 15: 35,640,544 S1352G probably benign Het
Zbtb38 C T 9: 96,688,383 R216H probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
R7763:Sorl1 UTSW 9 42043909 missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42089961 missense probably benign 0.17
R7956:Sorl1 UTSW 9 41989359 missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41991401 missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41977561 missense probably damaging 1.00
R8151:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R8219:Sorl1 UTSW 9 42041561 splice site probably null
R8261:Sorl1 UTSW 9 42014481 missense probably damaging 1.00
R8283:Sorl1 UTSW 9 42030998 missense probably damaging 1.00
R8308:Sorl1 UTSW 9 42018160 missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8448:Sorl1 UTSW 9 41991745 missense probably benign 0.35
R8524:Sorl1 UTSW 9 41974074 missense probably damaging 1.00
R8869:Sorl1 UTSW 9 42022426 missense probably benign 0.01
R8898:Sorl1 UTSW 9 42000271 missense probably damaging 1.00
R8972:Sorl1 UTSW 9 42046552 missense probably damaging 1.00
R9012:Sorl1 UTSW 9 42071195 missense probably damaging 1.00
R9094:Sorl1 UTSW 9 42063754 missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41974124 nonsense probably null
R9278:Sorl1 UTSW 9 42046561 missense probably benign 0.01
R9288:Sorl1 UTSW 9 42041631 missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41989443 missense probably damaging 1.00
R9330:Sorl1 UTSW 9 42067933 missense probably damaging 1.00
R9332:Sorl1 UTSW 9 42001518 missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42124088 missense probably benign 0.20
R9528:Sorl1 UTSW 9 42022335 critical splice donor site probably null
R9544:Sorl1 UTSW 9 42081809 nonsense probably null
R9563:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9564:Sorl1 UTSW 9 42046597 missense probably damaging 1.00
R9588:Sorl1 UTSW 9 42081809 nonsense probably null
R9634:Sorl1 UTSW 9 41996294 missense probably benign
R9671:Sorl1 UTSW 9 42031781 missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42092470 missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42099203 missense possibly damaging 0.64
Z1176:Sorl1 UTSW 9 42123948 missense probably benign 0.03
Z1177:Sorl1 UTSW 9 41991638 missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42106541 missense probably benign 0.00
Z1177:Sorl1 UTSW 9 42123912 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-10-08