Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Zbtb38'

351940

Institutional Source

Beutler Lab

Gene Symbol

Zbtb38

Ensembl Gene

ENSMUSG00000040433

Gene Name

zinc finger and BTB domain containing 38

Synonyms

CIBZ, A930014K01Rik, Zenon homolog

MMRRC Submission

041924-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.486) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

96682770-96752831 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 96688383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 216 (R216H)

Ref Sequence

ENSEMBL: ENSMUSP00000121753 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093798] [ENSMUST00000126066] [ENSMUST00000128269] [ENSMUST00000140121] [ENSMUST00000152594]

AlphaFold

Q3LR78

Predicted Effect

probably damaging
Transcript: ENSMUST00000093798
AA Change: R216H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000091315
Gene: ENSMUSG00000040433
AA Change: R216H

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126066
AA Change: R216H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000114300
Gene: ENSMUSG00000040433
AA Change: R216H

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	926	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128269

SMART Domains

Protein: ENSMUSP00000121871
Gene: ENSMUSG00000040433

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140121
AA Change: R216H

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000120040
Gene: ENSMUSG00000040433
AA Change: R216H

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000152594
AA Change: R216H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000121753
Gene: ENSMUSG00000040433
AA Change: R216H

Domain	Start	End	E-Value	Type
BTB	33	131	5.68e-20	SMART
low complexity region	140	151	N/A	INTRINSIC
ZnF_C2H2	340	362	7.67e-2	SMART
ZnF_C2H2	369	396	7.29e0	SMART
low complexity region	435	446	N/A	INTRINSIC
ZnF_C2H2	458	480	2.2e-2	SMART
ZnF_C2H2	486	508	1.05e1	SMART
ZnF_C2H2	514	537	8.09e-1	SMART
low complexity region	911	935	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
ZnF_C2H2	1013	1035	3.63e-3	SMART
ZnF_C2H2	1041	1063	9.73e-4	SMART
ZnF_C2H2	1069	1091	1.45e-2	SMART
ZnF_C2H2	1097	1119	1.02e1	SMART
ZnF_C2H2	1128	1150	1.67e-2	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het

Other mutations in Zbtb38

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Zbtb38	APN	9	96687494	missense	probably damaging	1.00
IGL01895:Zbtb38	APN	9	96688408	missense	probably benign	0.00
IGL02513:Zbtb38	APN	9	96687073	missense	probably damaging	1.00
IGL02649:Zbtb38	APN	9	96686619	missense	probably damaging	0.96
IGL02938:Zbtb38	APN	9	96687174	missense	probably benign	0.11
PIT4131001:Zbtb38	UTSW	9	96686316	missense	probably damaging	1.00
R0048:Zbtb38	UTSW	9	96687676	missense	probably damaging	1.00
R0152:Zbtb38	UTSW	9	96686280	missense	probably damaging	1.00
R0158:Zbtb38	UTSW	9	96686940	missense	possibly damaging	0.46
R0519:Zbtb38	UTSW	9	96685773	missense	probably damaging	1.00
R0594:Zbtb38	UTSW	9	96685954	missense	probably damaging	1.00
R1556:Zbtb38	UTSW	9	96686991	missense	probably benign	0.26
R1698:Zbtb38	UTSW	9	96685462	missense	probably benign
R1772:Zbtb38	UTSW	9	96688041	missense	probably damaging	1.00
R1799:Zbtb38	UTSW	9	96688881	missense	probably damaging	1.00
R1837:Zbtb38	UTSW	9	96686995	missense	probably benign
R2446:Zbtb38	UTSW	9	96687646	missense	probably damaging	1.00
R3153:Zbtb38	UTSW	9	96688249	missense	probably benign	0.34
R3950:Zbtb38	UTSW	9	96687546	missense	probably damaging	1.00
R4240:Zbtb38	UTSW	9	96686102	small deletion	probably benign
R4630:Zbtb38	UTSW	9	96688851	missense	probably damaging	1.00
R4732:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4733:Zbtb38	UTSW	9	96687684	missense	probably damaging	1.00
R4824:Zbtb38	UTSW	9	96688201	missense	probably benign	0.06
R5006:Zbtb38	UTSW	9	96685651	missense	probably damaging	1.00
R5109:Zbtb38	UTSW	9	96687009	missense	probably damaging	0.99
R5251:Zbtb38	UTSW	9	96687108	missense	probably benign	0.43
R5396:Zbtb38	UTSW	9	96687643	missense	probably damaging	1.00
R5659:Zbtb38	UTSW	9	96687420	missense	probably damaging	1.00
R6249:Zbtb38	UTSW	9	96685992	missense	probably damaging	0.99
R6294:Zbtb38	UTSW	9	96687229	missense	probably benign	0.05
R6615:Zbtb38	UTSW	9	96686654	nonsense	probably null
R6625:Zbtb38	UTSW	9	96687313	missense	probably damaging	1.00
R6885:Zbtb38	UTSW	9	96686464	missense	probably damaging	1.00
R7304:Zbtb38	UTSW	9	96687427	missense	probably damaging	0.96
R7675:Zbtb38	UTSW	9	96685541	missense	probably benign	0.00
R7823:Zbtb38	UTSW	9	96685976	nonsense	probably null
R7900:Zbtb38	UTSW	9	96688936	missense	probably damaging	1.00
R8077:Zbtb38	UTSW	9	96688100	missense	probably benign
R8432:Zbtb38	UTSW	9	96686238	missense	possibly damaging	0.68
R8802:Zbtb38	UTSW	9	96685570	missense	probably benign	0.13
R8930:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R8932:Zbtb38	UTSW	9	96686381	missense	probably benign	0.04
R9008:Zbtb38	UTSW	9	96687047	missense	probably benign
R9347:Zbtb38	UTSW	9	96685596	missense	probably damaging	0.99
R9520:Zbtb38	UTSW	9	96686051	missense	probably damaging	0.99
R9568:Zbtb38	UTSW	9	96688891	missense	probably damaging	1.00
R9680:Zbtb38	UTSW	9	96688344	missense	probably benign	0.03
R9777:Zbtb38	UTSW	9	96688302	missense	possibly damaging	0.49
R9777:Zbtb38	UTSW	9	96688303	missense	probably damaging	0.96
R9790:Zbtb38	UTSW	9	96688647	missense	probably damaging	1.00
R9791:Zbtb38	UTSW	9	96688647	missense	probably damaging	1.00
X0066:Zbtb38	UTSW	9	96687612	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTCTGGGCAGGTTACTAGAG -3'
(R):5'- CTGTCACTAATGGGCCAAGG -3'

Sequencing Primer
(F):5'- ACTAGAGAGAGTGGCATATTTTCTG -3'
(R):5'- TGTCACTAATGGGCCAAGGATCAC -3'

Posted On

2015-10-08