Incidental Mutation 'R4666:Col6a6'
ID 351942
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 105566616-105705413 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105644541 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1249 (Y1249F)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098441] [ENSMUST00000166431]
AlphaFold Q8C6K9
Predicted Effect possibly damaging
Transcript: ENSMUST00000098441
AA Change: Y1249F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: Y1249F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166431
AA Change: Y1249F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: Y1249F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105,635,390 (GRCm39) critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105,659,611 (GRCm39) missense probably benign 0.04
IGL00917:Col6a6 APN 9 105,661,453 (GRCm39) splice site probably benign
IGL01385:Col6a6 APN 9 105,660,865 (GRCm39) missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105,663,157 (GRCm39) nonsense probably null
IGL01508:Col6a6 APN 9 105,604,365 (GRCm39) splice site probably benign
IGL01668:Col6a6 APN 9 105,586,470 (GRCm39) missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105,586,454 (GRCm39) missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105,566,825 (GRCm39) missense probably benign 0.02
IGL01934:Col6a6 APN 9 105,575,858 (GRCm39) critical splice donor site probably null
IGL01944:Col6a6 APN 9 105,661,108 (GRCm39) missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105,658,184 (GRCm39) missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105,644,398 (GRCm39) critical splice donor site probably null
IGL02129:Col6a6 APN 9 105,613,539 (GRCm39) splice site probably benign
IGL02201:Col6a6 APN 9 105,658,194 (GRCm39) missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105,661,300 (GRCm39) missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105,609,415 (GRCm39) missense probably benign 0.05
IGL02574:Col6a6 APN 9 105,659,390 (GRCm39) missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105,604,369 (GRCm39) critical splice donor site probably null
IGL02852:Col6a6 APN 9 105,661,272 (GRCm39) missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105,586,651 (GRCm39) missense probably benign 0.01
IGL03327:Col6a6 APN 9 105,644,433 (GRCm39) missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105,609,462 (GRCm39) missense probably benign 0.23
R0042:Col6a6 UTSW 9 105,657,896 (GRCm39) missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105,626,047 (GRCm39) splice site probably benign
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105,579,474 (GRCm39) missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105,644,487 (GRCm39) missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105,661,315 (GRCm39) missense probably benign 0.13
R0382:Col6a6 UTSW 9 105,632,754 (GRCm39) missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105,661,403 (GRCm39) missense probably benign 0.02
R0421:Col6a6 UTSW 9 105,661,405 (GRCm39) missense probably benign 0.02
R0502:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0503:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0600:Col6a6 UTSW 9 105,638,639 (GRCm39) missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105,654,943 (GRCm39) missense probably benign 0.45
R0629:Col6a6 UTSW 9 105,604,364 (GRCm39) splice site probably benign
R0690:Col6a6 UTSW 9 105,586,685 (GRCm39) missense probably benign 0.01
R1155:Col6a6 UTSW 9 105,659,289 (GRCm39) missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105,626,109 (GRCm39) missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105,651,502 (GRCm39) missense probably null 0.98
R1263:Col6a6 UTSW 9 105,586,688 (GRCm39) missense probably benign 0.01
R1296:Col6a6 UTSW 9 105,658,290 (GRCm39) missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105,586,672 (GRCm39) missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105,655,274 (GRCm39) missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105,654,748 (GRCm39) missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105,609,410 (GRCm39) critical splice donor site probably null
R1830:Col6a6 UTSW 9 105,579,469 (GRCm39) missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105,658,301 (GRCm39) missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105,586,583 (GRCm39) missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105,658,003 (GRCm39) missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105,631,422 (GRCm39) missense probably benign 0.01
R3176:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3276:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3429:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105,659,373 (GRCm39) missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105,657,891 (GRCm39) missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105,576,078 (GRCm39) missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105,661,155 (GRCm39) missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105,660,889 (GRCm39) missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105,576,148 (GRCm39) missense possibly damaging 0.64
R4905:Col6a6 UTSW 9 105,644,623 (GRCm39) missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105,666,147 (GRCm39) missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R5002:Col6a6 UTSW 9 105,663,292 (GRCm39) missense probably benign 0.00
R5111:Col6a6 UTSW 9 105,586,673 (GRCm39) missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105,659,232 (GRCm39) missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105,586,306 (GRCm39) missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105,651,537 (GRCm39) missense probably null 0.79
R5491:Col6a6 UTSW 9 105,615,435 (GRCm39) missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105,638,717 (GRCm39) critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105,644,274 (GRCm39) missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105,661,116 (GRCm39) missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105,604,426 (GRCm39) splice site probably null
R6425:Col6a6 UTSW 9 105,576,064 (GRCm39) missense probably benign 0.21
R6464:Col6a6 UTSW 9 105,666,152 (GRCm39) start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105,575,890 (GRCm39) missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105,663,024 (GRCm39) missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105,576,112 (GRCm39) missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105,660,879 (GRCm39) missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105,661,140 (GRCm39) missense probably benign 0.32
R7032:Col6a6 UTSW 9 105,644,707 (GRCm39) missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105,661,168 (GRCm39) missense probably benign 0.00
R7472:Col6a6 UTSW 9 105,659,622 (GRCm39) missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105,644,523 (GRCm39) missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R7716:Col6a6 UTSW 9 105,661,102 (GRCm39) missense possibly damaging 0.84
R7866:Col6a6 UTSW 9 105,566,760 (GRCm39) missense probably damaging 0.96
R7938:Col6a6 UTSW 9 105,657,883 (GRCm39) nonsense probably null
R8016:Col6a6 UTSW 9 105,644,727 (GRCm39) missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105,576,219 (GRCm39) missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105,659,146 (GRCm39) missense probably benign 0.01
R8082:Col6a6 UTSW 9 105,661,129 (GRCm39) nonsense probably null
R8243:Col6a6 UTSW 9 105,576,468 (GRCm39) missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105,661,272 (GRCm39) missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105,632,853 (GRCm39) missense probably benign 0.25
R8384:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105,651,995 (GRCm39) missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105,651,987 (GRCm39) missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105,663,348 (GRCm39) missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105,644,528 (GRCm39) missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105,586,745 (GRCm39) missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105,661,276 (GRCm39) missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105,659,169 (GRCm39) missense probably benign 0.30
R9225:Col6a6 UTSW 9 105,659,437 (GRCm39) missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105,651,757 (GRCm39) missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105,663,172 (GRCm39) missense probably benign 0.00
R9360:Col6a6 UTSW 9 105,644,686 (GRCm39) missense probably benign 0.00
R9368:Col6a6 UTSW 9 105,663,300 (GRCm39) missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105,651,825 (GRCm39) missense probably benign 0.40
R9450:Col6a6 UTSW 9 105,661,373 (GRCm39) missense probably benign
R9454:Col6a6 UTSW 9 105,661,059 (GRCm39) missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105,586,361 (GRCm39) missense probably benign 0.01
R9563:Col6a6 UTSW 9 105,572,952 (GRCm39) missense probably benign 0.02
R9568:Col6a6 UTSW 9 105,657,926 (GRCm39) missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105,616,401 (GRCm39) missense probably benign 0.07
R9664:Col6a6 UTSW 9 105,658,254 (GRCm39) missense probably benign 0.11
R9747:Col6a6 UTSW 9 105,661,239 (GRCm39) missense probably benign 0.29
R9760:Col6a6 UTSW 9 105,659,253 (GRCm39) missense probably damaging 0.99
X0022:Col6a6 UTSW 9 105,576,531 (GRCm39) missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105,658,151 (GRCm39) missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105,666,094 (GRCm39) missense probably null 0.24
Z1177:Col6a6 UTSW 9 105,605,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCACTGAAAACTGCAGACTG -3'
(R):5'- CCCCTTGGATCCTAGATTGC -3'

Sequencing Primer
(F):5'- TGAAAACTGCAGACTGACACAC -3'
(R):5'- GTTGGATTTGACATCTCAAGCC -3'
Posted On 2015-10-08