Incidental Mutation 'R4666:Ebf1'
ID 351948
Institutional Source Beutler Lab
Gene Symbol Ebf1
Ensembl Gene ENSMUSG00000057098
Gene Name early B cell factor 1
Synonyms Olf1, O/E-1, Olf-1
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.896) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 44508144-44898918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44882384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 447 (N447D)
Ref Sequence ENSEMBL: ENSMUSP00000099857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081265] [ENSMUST00000101326] [ENSMUST00000109268]
AlphaFold Q07802
Predicted Effect probably benign
Transcript: ENSMUST00000081265
AA Change: N446D

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000080020
Gene: ENSMUSG00000057098
AA Change: N446D

DomainStartEndE-ValueType
IPT 261 345 7.38e-8 SMART
HLH 346 395 5.4e-2 SMART
low complexity region 526 544 N/A INTRINSIC
low complexity region 564 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101326
AA Change: N447D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099857
Gene: ENSMUSG00000057098
AA Change: N447D

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 8e-150 PFAM
IPT 262 346 7.38e-8 SMART
HLH 347 396 5.4e-2 SMART
low complexity region 527 545 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109268
AA Change: N439D

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104891
Gene: ENSMUSG00000057098
AA Change: N439D

DomainStartEndE-ValueType
IPT 254 338 7.38e-8 SMART
HLH 339 388 5.4e-2 SMART
low complexity region 519 537 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit a reduced striatum due to excess apoptosis, altered facial branchiomotor neurone migration, and a block in B cell differentiation. Mutants are smaller than normal and many die prior to 4 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Ebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Ebf1 APN 11 44,759,927 (GRCm39) missense probably damaging 1.00
IGL02228:Ebf1 APN 11 44,863,739 (GRCm39) missense probably damaging 1.00
IGL02430:Ebf1 APN 11 44,815,403 (GRCm39) critical splice donor site probably null
Befuddled UTSW 11 44,523,602 (GRCm39) missense probably damaging 0.98
Catastrophic UTSW 11 44,774,712 (GRCm39) missense probably damaging 1.00
Crabapple UTSW 11 44,774,666 (GRCm39) missense probably damaging 1.00
Crater_lake UTSW 11 44,863,735 (GRCm39) nonsense probably null
ebby UTSW 11 44,774,641 (GRCm39) missense probably damaging 1.00
Oregano UTSW 11 44,759,996 (GRCm39) missense probably damaging 1.00
Oregano2 UTSW 11 44,881,331 (GRCm39) splice site probably null
Realtor UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
Vie UTSW 11 44,863,742 (GRCm39) missense probably damaging 1.00
R0102:Ebf1 UTSW 11 44,882,282 (GRCm39) missense probably benign 0.02
R0102:Ebf1 UTSW 11 44,882,282 (GRCm39) missense probably benign 0.02
R0141:Ebf1 UTSW 11 44,798,827 (GRCm39) missense probably damaging 1.00
R0230:Ebf1 UTSW 11 44,886,949 (GRCm39) missense probably damaging 1.00
R0243:Ebf1 UTSW 11 44,759,915 (GRCm39) splice site probably benign
R0268:Ebf1 UTSW 11 44,534,240 (GRCm39) missense probably damaging 0.96
R0414:Ebf1 UTSW 11 44,815,297 (GRCm39) nonsense probably null
R0648:Ebf1 UTSW 11 44,882,337 (GRCm39) missense probably damaging 0.99
R0765:Ebf1 UTSW 11 44,759,987 (GRCm39) missense probably damaging 0.97
R1055:Ebf1 UTSW 11 44,523,602 (GRCm39) missense probably damaging 0.98
R1432:Ebf1 UTSW 11 44,895,533 (GRCm39) splice site probably benign
R1713:Ebf1 UTSW 11 44,815,393 (GRCm39) missense probably damaging 1.00
R1749:Ebf1 UTSW 11 44,798,835 (GRCm39) missense possibly damaging 0.68
R1989:Ebf1 UTSW 11 44,512,793 (GRCm39) missense probably damaging 0.97
R2405:Ebf1 UTSW 11 44,882,349 (GRCm39) missense probably damaging 0.98
R3110:Ebf1 UTSW 11 44,534,225 (GRCm39) splice site probably benign
R4538:Ebf1 UTSW 11 44,798,822 (GRCm39) missense probably benign 0.07
R4855:Ebf1 UTSW 11 44,863,735 (GRCm39) nonsense probably null
R4904:Ebf1 UTSW 11 44,759,996 (GRCm39) missense probably damaging 1.00
R5137:Ebf1 UTSW 11 44,882,295 (GRCm39) missense probably damaging 1.00
R5569:Ebf1 UTSW 11 44,883,228 (GRCm39) missense possibly damaging 0.82
R5849:Ebf1 UTSW 11 44,881,331 (GRCm39) splice site probably null
R5940:Ebf1 UTSW 11 44,512,048 (GRCm39) missense probably damaging 1.00
R5989:Ebf1 UTSW 11 44,886,998 (GRCm39) missense probably damaging 1.00
R6170:Ebf1 UTSW 11 44,774,712 (GRCm39) missense probably damaging 1.00
R6512:Ebf1 UTSW 11 44,883,168 (GRCm39) missense probably damaging 1.00
R6747:Ebf1 UTSW 11 44,774,641 (GRCm39) missense probably damaging 1.00
R7031:Ebf1 UTSW 11 44,512,795 (GRCm39) missense possibly damaging 0.95
R7042:Ebf1 UTSW 11 44,882,338 (GRCm39) missense probably damaging 0.99
R8065:Ebf1 UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
R8067:Ebf1 UTSW 11 44,511,374 (GRCm39) missense probably benign 0.05
R8125:Ebf1 UTSW 11 44,863,742 (GRCm39) missense probably damaging 1.00
R8413:Ebf1 UTSW 11 44,534,274 (GRCm39) missense possibly damaging 0.92
R8863:Ebf1 UTSW 11 44,774,666 (GRCm39) missense probably damaging 1.00
R9178:Ebf1 UTSW 11 44,895,548 (GRCm39) missense probably benign 0.20
R9178:Ebf1 UTSW 11 44,883,276 (GRCm39) missense probably benign 0.04
R9511:Ebf1 UTSW 11 44,815,393 (GRCm39) missense probably benign 0.03
R9603:Ebf1 UTSW 11 44,509,006 (GRCm39) start codon destroyed probably null 0.07
Predicted Primers PCR Primer
(F):5'- AAAGACGTGCCTTTGACTTTTC -3'
(R):5'- ACAAGTGAAGAATCGCCTCC -3'

Sequencing Primer
(F):5'- GCCTTTGACTTTTCAGGAGATTATC -3'
(R):5'- CAAGTGAAGAATCGCCTCCTTTAG -3'
Posted On 2015-10-08