Incidental Mutation 'R4666:Galr2'
ID 351955
Institutional Source Beutler Lab
Gene Symbol Galr2
Ensembl Gene ENSMUSG00000020793
Gene Name galanin receptor 2
Synonyms GalR2, mGalR
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 116171765-116174764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116174455 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 362 (T362A)
Ref Sequence ENSEMBL: ENSMUSP00000054062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000055872] [ENSMUST00000106411] [ENSMUST00000106413]
AlphaFold O88854
Predicted Effect probably benign
Transcript: ENSMUST00000021147
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055872
AA Change: T362A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054062
Gene: ENSMUSG00000020793
AA Change: T362A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 306 4.1e-12 PFAM
Pfam:7tm_1 41 291 6.4e-52 PFAM
Pfam:7TM_GPCR_Srv 62 307 1.2e-7 PFAM
Pfam:7TM_GPCR_Srw 184 308 4.7e-8 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106411
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106413
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154277
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Galanin is an important neuromodulator present in the brain, gastrointestinal system, and hypothalamopituitary axis. It is a 30-amino acid non-C-terminally amidated peptide that potently stimulates growth hormone secretion, inhibits cardiac vagal slowing of heart rate, abolishes sinus arrhythmia, and inhibits postprandial gastrointestinal motility. The actions of galanin are mediated through interaction with specific membrane receptors that are members of the 7-transmembrane family of G protein-coupled receptors. GALR2 interacts with the N-terminal residues of the galanin peptide. The primary signaling mechanism for GALR2 is through the phospholipase C/protein kinase C pathway (via Gq), in contrast to GALR1, which communicates its intracellular signal by inhibition of adenylyl cyclase through Gi. However, it has been demonstrated that GALR2 couples efficiently to both the Gq and Gi proteins to simultaneously activate 2 independent signal transduction pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduction in exploratory activity. There is also a modest shift in the distribution of different lymphocyte cell types. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Sbf1 C T 15: 89,179,449 (GRCm39) V1385M probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Galr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Galr2 APN 11 116,173,996 (GRCm39) missense probably damaging 1.00
PIT4418001:Galr2 UTSW 11 116,174,084 (GRCm39) missense probably benign 0.35
PIT4445001:Galr2 UTSW 11 116,172,474 (GRCm39) missense probably benign 0.13
R0426:Galr2 UTSW 11 116,172,517 (GRCm39) missense probably damaging 1.00
R1869:Galr2 UTSW 11 116,174,069 (GRCm39) missense possibly damaging 0.87
R2059:Galr2 UTSW 11 116,173,765 (GRCm39) missense probably damaging 1.00
R4579:Galr2 UTSW 11 116,172,325 (GRCm39) missense probably benign
R5832:Galr2 UTSW 11 116,172,457 (GRCm39) missense probably damaging 1.00
R5974:Galr2 UTSW 11 116,173,852 (GRCm39) missense possibly damaging 0.62
R7081:Galr2 UTSW 11 116,173,874 (GRCm39) missense probably damaging 0.99
R7155:Galr2 UTSW 11 116,174,408 (GRCm39) missense possibly damaging 0.94
R7696:Galr2 UTSW 11 116,173,993 (GRCm39) missense probably damaging 1.00
R7810:Galr2 UTSW 11 116,173,946 (GRCm39) missense probably benign 0.23
R8921:Galr2 UTSW 11 116,173,973 (GRCm39) missense probably damaging 1.00
R9231:Galr2 UTSW 11 116,174,335 (GRCm39) missense probably benign
R9514:Galr2 UTSW 11 116,174,452 (GRCm39) missense probably benign
X0009:Galr2 UTSW 11 116,174,149 (GRCm39) missense probably benign 0.14
X0026:Galr2 UTSW 11 116,172,577 (GRCm39) missense probably benign
Predicted Primers
Posted On 2015-10-08