Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Adamts12'

351966

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

041924-MU

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11311492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1278 (N1278K)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061318
AA Change: N1278K

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: N1278K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R4929:Adamts12	UTSW	15	11259022	missense	probably damaging	0.96
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCTCCACCAACATCTTATATGGGG -3'
(R):5'- TGTCACAGGTAGAAAGTACATCC -3'

Sequencing Primer
(F):5'- CAACATCTTATATGGGGGAAGAGCCC -3'
(R):5'- CAGGTAGAAAGTACATCCTTTGATAG -3'

Posted On

2015-10-08