Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Sbf1'

351971

Institutional Source

Beutler Lab

Gene Symbol

Sbf1

Ensembl Gene

ENSMUSG00000036529

Gene Name

SET binding factor 1

Synonyms

B230113C15Rik, 2610510A08Rik, Mtmr5

MMRRC Submission

041924-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.521) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89288236-89315311 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89295246 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 1385 (V1385M)

Ref Sequence

ENSEMBL: ENSMUSP00000118107 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]

AlphaFold

Q6ZPE2

PDB Structure

Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000123791
AA Change: V1359M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: V1359M

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	540	764	4.1e-110	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1100	1534	6.2e-114	PFAM
low complexity region	1614	1621	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	1719	1750	N/A	INTRINSIC
PH	1762	1867	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124398

Predicted Effect

probably benign
Transcript: ENSMUST00000124576

SMART Domains

Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
Pfam:dDENN	363	403	4.6e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144585
AA Change: V1385M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: V1385M

Domain	Start	End	E-Value	Type
uDENN	1	86	6.68e-31	SMART
DENN	128	310	4.05e-71	SMART
dDENN	363	432	1.28e-18	SMART
Pfam:SBF2	542	764	2.3e-108	PFAM
GRAM	882	968	3.93e-12	SMART
Pfam:Myotub-related	1106	1558	5.7e-93	PFAM
low complexity region	1640	1647	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
low complexity region	1745	1776	N/A	INTRINSIC
PH	1788	1893	6.45e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150539

Predicted Effect

probably benign
Transcript: ENSMUST00000175778

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177388

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Epg5	A	G	18: 78,012,864	N1751S	probably benign	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Sbf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00265:Sbf1	APN	15	89305575	missense	probably damaging	0.98
IGL01478:Sbf1	APN	15	89299743	missense	probably damaging	0.97
IGL01533:Sbf1	APN	15	89288716	missense	probably damaging	0.99
IGL01603:Sbf1	APN	15	89303278	missense	probably damaging	1.00
IGL01758:Sbf1	APN	15	89303215	unclassified	probably benign
IGL01908:Sbf1	APN	15	89302726	missense	probably damaging	1.00
IGL02067:Sbf1	APN	15	89289044	missense	probably damaging	1.00
IGL02089:Sbf1	APN	15	89302505	nonsense	probably null
IGL02150:Sbf1	APN	15	89295480	missense	probably benign	0.00
IGL02284:Sbf1	APN	15	89305078	missense	probably damaging	1.00
IGL02367:Sbf1	APN	15	89307572	missense	probably damaging	0.99
IGL02427:Sbf1	APN	15	89305985	unclassified	probably benign
IGL03025:Sbf1	APN	15	89289645	missense	probably damaging	1.00
IGL03103:Sbf1	APN	15	89293947	missense	probably damaging	1.00
IGL03226:Sbf1	APN	15	89289105	missense	possibly damaging	0.93
IGL03376:Sbf1	APN	15	89289016	unclassified	probably benign
IGL03397:Sbf1	APN	15	89288721	missense	probably damaging	1.00
R0043:Sbf1	UTSW	15	89295561	missense	probably benign	0.26
R0139:Sbf1	UTSW	15	89302498	missense	probably damaging	1.00
R0528:Sbf1	UTSW	15	89288712	missense	probably damaging	0.99
R0624:Sbf1	UTSW	15	89302329	missense	possibly damaging	0.68
R0759:Sbf1	UTSW	15	89304716	missense	probably damaging	1.00
R1555:Sbf1	UTSW	15	89305076	missense	probably damaging	1.00
R1763:Sbf1	UTSW	15	89294425	missense	probably damaging	1.00
R2025:Sbf1	UTSW	15	89302730	missense	probably damaging	1.00
R2207:Sbf1	UTSW	15	89306693	missense	possibly damaging	0.88
R2844:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R2845:Sbf1	UTSW	15	89303218	critical splice donor site	probably null
R3788:Sbf1	UTSW	15	89299528	nonsense	probably null
R4108:Sbf1	UTSW	15	89288585	unclassified	probably benign
R4403:Sbf1	UTSW	15	89293954	missense	possibly damaging	0.94
R4605:Sbf1	UTSW	15	89303481	missense	probably damaging	1.00
R4620:Sbf1	UTSW	15	89306926	missense	probably damaging	0.99
R4696:Sbf1	UTSW	15	89303112	nonsense	probably null
R4697:Sbf1	UTSW	15	89315085	missense	possibly damaging	0.71
R4747:Sbf1	UTSW	15	89302713	missense	probably damaging	1.00
R5828:Sbf1	UTSW	15	89288634	missense	probably damaging	1.00
R5841:Sbf1	UTSW	15	89308068	missense	probably damaging	1.00
R6185:Sbf1	UTSW	15	89305611	missense	probably damaging	1.00
R6237:Sbf1	UTSW	15	89293476	missense	probably benign	0.29
R6256:Sbf1	UTSW	15	89300867	missense	probably benign	0.06
R6490:Sbf1	UTSW	15	89304908	missense	probably benign
R6933:Sbf1	UTSW	15	89300369	missense	probably damaging	1.00
R7806:Sbf1	UTSW	15	89305420	missense	possibly damaging	0.52
R7921:Sbf1	UTSW	15	89306223	missense	probably damaging	0.96
R8005:Sbf1	UTSW	15	89294205	missense	probably damaging	0.98
R8350:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8450:Sbf1	UTSW	15	89299509	missense	probably damaging	0.99
R8509:Sbf1	UTSW	15	89293457	missense	probably damaging	1.00
R8753:Sbf1	UTSW	15	89295459	missense	probably benign
R8788:Sbf1	UTSW	15	89301859	missense	probably damaging	1.00
R9182:Sbf1	UTSW	15	89289603	critical splice donor site	probably null
R9516:Sbf1	UTSW	15	89300539	missense	probably damaging	1.00
R9608:Sbf1	UTSW	15	89307605	critical splice acceptor site	probably null
R9673:Sbf1	UTSW	15	89295472	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TGCCCAAGGTGTCAAGCAAG -3'
(R):5'- TGGTTTTCTACGGCCACAGC -3'

Sequencing Primer
(F):5'- GGTGTCAAGCAAGCAAGCCC -3'
(R):5'- AGCCCTCTACATCATTGGTGAC -3'

Posted On

2015-10-08