Incidental Mutation 'R4666:Sbf1'
ID 351971
Institutional Source Beutler Lab
Gene Symbol Sbf1
Ensembl Gene ENSMUSG00000036529
Gene Name SET binding factor 1
Synonyms B230113C15Rik, 2610510A08Rik, Mtmr5
MMRRC Submission 041924-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R4666 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 89172439-89199514 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 89179449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1385 (V1385M)
Ref Sequence ENSEMBL: ENSMUSP00000118107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123791] [ENSMUST00000124576] [ENSMUST00000144585]
AlphaFold Q6ZPE2
PDB Structure Solution Structure of the C-terminal Pleckstrin Homology Domain of Sbf1 from Mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000123791
AA Change: V1359M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120725
Gene: ENSMUSG00000036529
AA Change: V1359M

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 540 764 4.1e-110 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1100 1534 6.2e-114 PFAM
low complexity region 1614 1621 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 1719 1750 N/A INTRINSIC
PH 1762 1867 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124398
Predicted Effect probably benign
Transcript: ENSMUST00000124576
SMART Domains Protein: ENSMUSP00000115740
Gene: ENSMUSG00000036529

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
Pfam:dDENN 363 403 4.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144585
AA Change: V1385M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118107
Gene: ENSMUSG00000036529
AA Change: V1385M

DomainStartEndE-ValueType
uDENN 1 86 6.68e-31 SMART
DENN 128 310 4.05e-71 SMART
dDENN 363 432 1.28e-18 SMART
Pfam:SBF2 542 764 2.3e-108 PFAM
GRAM 882 968 3.93e-12 SMART
Pfam:Myotub-related 1106 1558 5.7e-93 PFAM
low complexity region 1640 1647 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
low complexity region 1745 1776 N/A INTRINSIC
PH 1788 1893 6.45e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150539
Predicted Effect probably benign
Transcript: ENSMUST00000175778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177388
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein-tyrosine phosphatase family. However, the encoded protein does not appear to be a catalytically active phosphatase because it lacks several amino acids in the catalytic pocket. This protein contains a Guanine nucleotide exchange factor (GEF) domain which is necessary for its role in growth and differentiation. Mutations in this gene have been associated with Charcot-Marie-Tooth disease 4B3. Pseudogenes of this gene have been defined on chromosomes 1 and 8. [provided by RefSeq, Dec 2014]
PHENOTYPE: Male homozygotes for a targeted null mutation exhibit male infertility associated with azoospermia, vacuolation of Sertoli cells, reduced spermatid formation, and eventual depletion of germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik G A 17: 37,289,794 (GRCm39) S12L probably benign Het
Abce1 A G 8: 80,414,115 (GRCm39) V532A probably damaging Het
Adamts12 T A 15: 11,311,578 (GRCm39) N1278K probably benign Het
Adipor1 T A 1: 134,352,643 (GRCm39) I138N probably damaging Het
Aox1 C T 1: 58,343,756 (GRCm39) Q480* probably null Het
Arhgef38 C T 3: 132,846,533 (GRCm39) probably null Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Bltp3a G T 17: 28,112,477 (GRCm39) W1222L possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Cdh8 T C 8: 99,751,534 (GRCm39) T728A possibly damaging Het
Celsr1 A G 15: 85,914,695 (GRCm39) S1093P probably damaging Het
Cep135 C A 5: 76,764,701 (GRCm39) P560T probably benign Het
Chfr C T 5: 110,292,733 (GRCm39) Q167* probably null Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cntln A G 4: 84,889,453 (GRCm39) N312S probably benign Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col6a6 T A 9: 105,644,541 (GRCm39) Y1249F possibly damaging Het
Cpsf2 T C 12: 101,949,466 (GRCm39) S61P probably damaging Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cryba2 C T 1: 74,929,207 (GRCm39) D179N probably benign Het
Daglb A T 5: 143,489,104 (GRCm39) R654W probably damaging Het
Dennd3 A G 15: 73,442,709 (GRCm39) D1244G probably damaging Het
Dhx57 T C 17: 80,582,390 (GRCm39) E405G probably damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dph1 A G 11: 75,072,156 (GRCm39) S238P probably damaging Het
Duox1 C T 2: 122,149,956 (GRCm39) P116S probably benign Het
Ebf1 A G 11: 44,882,384 (GRCm39) N447D probably damaging Het
Epg5 A G 18: 78,056,079 (GRCm39) N1751S probably benign Het
Exoc6 A G 19: 37,558,953 (GRCm39) D75G probably damaging Het
Extl2 T A 3: 115,817,856 (GRCm39) I70N probably damaging Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fbln7 T A 2: 128,736,830 (GRCm39) probably null Het
Foxa3 G T 7: 18,748,297 (GRCm39) C275* probably null Het
Foxred1 C T 9: 35,122,151 (GRCm39) probably benign Het
Galr2 A G 11: 116,174,455 (GRCm39) T362A probably benign Het
Garem2 C A 5: 30,319,665 (GRCm39) R376S probably damaging Het
Garre1 T C 7: 33,984,198 (GRCm39) M142V probably damaging Het
Gatc T A 5: 115,473,606 (GRCm39) N111I probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gm9894 T C 13: 67,913,213 (GRCm39) noncoding transcript Het
Gtdc1 T C 2: 44,481,937 (GRCm39) N301S probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtsf1 T C 15: 103,329,632 (GRCm39) I96V probably benign Het
Homer1 T A 13: 93,538,667 (GRCm39) I170N probably damaging Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hoxb9 A G 11: 96,165,657 (GRCm39) K242R possibly damaging Het
Ifna14 T C 4: 88,489,573 (GRCm39) R155G probably benign Het
Lrrc7 GAAGTTGTTTGGAGATTCTTATCTTA GA 3: 158,024,045 (GRCm39) probably benign Het
Lsm11 A G 11: 45,824,640 (GRCm39) S296P probably damaging Het
Macrod2 T C 2: 142,059,519 (GRCm39) L265P probably damaging Het
Mcu G A 10: 59,292,521 (GRCm39) L53F probably damaging Het
Mpv17l2 A G 8: 71,213,061 (GRCm39) V104A possibly damaging Het
Myh10 G A 11: 68,692,556 (GRCm39) probably null Het
Nemf T C 12: 69,359,054 (GRCm39) E1031G probably damaging Het
Nhsl1 G A 10: 18,407,153 (GRCm39) S1395N probably damaging Het
Niban3 G T 8: 72,056,469 (GRCm39) E390* probably null Het
Nlrp2 T A 7: 5,322,188 (GRCm39) I82F probably benign Het
Nlrp4e T A 7: 23,036,205 (GRCm39) L686* probably null Het
Nudt12os T A 17: 59,331,546 (GRCm39) noncoding transcript Het
Or10ag57 T A 2: 87,218,220 (GRCm39) I57K probably damaging Het
Or10j5 G A 1: 172,785,157 (GRCm39) S265N probably benign Het
Or2h1b A T 17: 37,462,270 (GRCm39) S44T possibly damaging Het
Or5ac23 A G 16: 59,149,573 (GRCm39) Y100H possibly damaging Het
Or5k16 T C 16: 58,736,947 (GRCm39) D19G probably benign Het
Or8g27 T A 9: 39,129,142 (GRCm39) M163K probably damaging Het
Pde7a T C 3: 19,314,420 (GRCm39) T59A probably damaging Het
Pde7b A C 10: 20,314,496 (GRCm39) D203E probably damaging Het
Phkg2 T A 7: 127,177,156 (GRCm39) I94N possibly damaging Het
Pik3r2 G A 8: 71,221,503 (GRCm39) T667I possibly damaging Het
Pitx3 T A 19: 46,125,540 (GRCm39) H68L possibly damaging Het
Prcd A G 11: 116,558,990 (GRCm39) probably benign Het
Prune2 C T 19: 17,097,552 (GRCm39) R1019* probably null Het
Psap A G 10: 60,136,324 (GRCm39) D486G probably benign Het
Purb A T 11: 6,425,615 (GRCm39) V91E probably damaging Het
Recql C A 6: 142,322,567 (GRCm39) V112F probably damaging Het
Rptor A T 11: 119,634,708 (GRCm39) I175F probably damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Slc35f6 T C 5: 30,812,957 (GRCm39) L37P probably damaging Het
Slc6a3 T A 13: 73,686,700 (GRCm39) N22K possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Sp6 C A 11: 96,912,701 (GRCm39) A138E probably benign Het
Spag8 G T 4: 43,653,408 (GRCm39) probably benign Het
Spmip4 G T 6: 50,572,808 (GRCm39) T35K possibly damaging Het
Spon1 T A 7: 113,628,204 (GRCm39) M320K probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmprss11d T C 5: 86,457,260 (GRCm39) D133G probably damaging Het
Trav13n-3 T A 14: 53,574,953 (GRCm39) V65D probably damaging Het
Trpm1 G T 7: 63,852,782 (GRCm39) L65F probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ube2v1 T A 2: 167,452,297 (GRCm39) Y102F probably damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Vcan C A 13: 89,828,053 (GRCm39) W2171L probably damaging Het
Vinac1 T C 2: 128,880,150 (GRCm39) H592R probably benign Het
Vmn1r64 T C 7: 5,887,357 (GRCm39) N62S probably damaging Het
Vmn2r67 T C 7: 84,799,831 (GRCm39) D469G probably benign Het
Vps13b A G 15: 35,640,690 (GRCm39) S1352G probably benign Het
Zbtb38 C T 9: 96,570,436 (GRCm39) R216H probably damaging Het
Other mutations in Sbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00265:Sbf1 APN 15 89,189,778 (GRCm39) missense probably damaging 0.98
IGL01478:Sbf1 APN 15 89,183,946 (GRCm39) missense probably damaging 0.97
IGL01533:Sbf1 APN 15 89,172,919 (GRCm39) missense probably damaging 0.99
IGL01603:Sbf1 APN 15 89,187,481 (GRCm39) missense probably damaging 1.00
IGL01758:Sbf1 APN 15 89,187,418 (GRCm39) unclassified probably benign
IGL01908:Sbf1 APN 15 89,186,929 (GRCm39) missense probably damaging 1.00
IGL02067:Sbf1 APN 15 89,173,247 (GRCm39) missense probably damaging 1.00
IGL02089:Sbf1 APN 15 89,186,708 (GRCm39) nonsense probably null
IGL02150:Sbf1 APN 15 89,179,683 (GRCm39) missense probably benign 0.00
IGL02284:Sbf1 APN 15 89,189,281 (GRCm39) missense probably damaging 1.00
IGL02367:Sbf1 APN 15 89,191,775 (GRCm39) missense probably damaging 0.99
IGL02427:Sbf1 APN 15 89,190,188 (GRCm39) unclassified probably benign
IGL03025:Sbf1 APN 15 89,173,848 (GRCm39) missense probably damaging 1.00
IGL03103:Sbf1 APN 15 89,178,150 (GRCm39) missense probably damaging 1.00
IGL03226:Sbf1 APN 15 89,173,308 (GRCm39) missense possibly damaging 0.93
IGL03376:Sbf1 APN 15 89,173,219 (GRCm39) unclassified probably benign
IGL03397:Sbf1 APN 15 89,172,924 (GRCm39) missense probably damaging 1.00
R0043:Sbf1 UTSW 15 89,179,764 (GRCm39) missense probably benign 0.26
R0139:Sbf1 UTSW 15 89,186,701 (GRCm39) missense probably damaging 1.00
R0528:Sbf1 UTSW 15 89,172,915 (GRCm39) missense probably damaging 0.99
R0624:Sbf1 UTSW 15 89,186,532 (GRCm39) missense possibly damaging 0.68
R0759:Sbf1 UTSW 15 89,188,919 (GRCm39) missense probably damaging 1.00
R1555:Sbf1 UTSW 15 89,189,279 (GRCm39) missense probably damaging 1.00
R1763:Sbf1 UTSW 15 89,178,628 (GRCm39) missense probably damaging 1.00
R2025:Sbf1 UTSW 15 89,186,933 (GRCm39) missense probably damaging 1.00
R2207:Sbf1 UTSW 15 89,190,896 (GRCm39) missense possibly damaging 0.88
R2844:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R2845:Sbf1 UTSW 15 89,187,421 (GRCm39) critical splice donor site probably null
R3788:Sbf1 UTSW 15 89,183,731 (GRCm39) nonsense probably null
R4108:Sbf1 UTSW 15 89,172,788 (GRCm39) unclassified probably benign
R4403:Sbf1 UTSW 15 89,178,157 (GRCm39) missense possibly damaging 0.94
R4605:Sbf1 UTSW 15 89,187,684 (GRCm39) missense probably damaging 1.00
R4620:Sbf1 UTSW 15 89,191,129 (GRCm39) missense probably damaging 0.99
R4696:Sbf1 UTSW 15 89,187,315 (GRCm39) nonsense probably null
R4697:Sbf1 UTSW 15 89,199,288 (GRCm39) missense possibly damaging 0.71
R4747:Sbf1 UTSW 15 89,186,916 (GRCm39) missense probably damaging 1.00
R5828:Sbf1 UTSW 15 89,172,837 (GRCm39) missense probably damaging 1.00
R5841:Sbf1 UTSW 15 89,192,271 (GRCm39) missense probably damaging 1.00
R6185:Sbf1 UTSW 15 89,189,814 (GRCm39) missense probably damaging 1.00
R6237:Sbf1 UTSW 15 89,177,679 (GRCm39) missense probably benign 0.29
R6256:Sbf1 UTSW 15 89,185,070 (GRCm39) missense probably benign 0.06
R6490:Sbf1 UTSW 15 89,189,111 (GRCm39) missense probably benign
R6933:Sbf1 UTSW 15 89,184,572 (GRCm39) missense probably damaging 1.00
R7806:Sbf1 UTSW 15 89,189,623 (GRCm39) missense possibly damaging 0.52
R7921:Sbf1 UTSW 15 89,190,426 (GRCm39) missense probably damaging 0.96
R8005:Sbf1 UTSW 15 89,178,408 (GRCm39) missense probably damaging 0.98
R8350:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8450:Sbf1 UTSW 15 89,183,712 (GRCm39) missense probably damaging 0.99
R8509:Sbf1 UTSW 15 89,177,660 (GRCm39) missense probably damaging 1.00
R8753:Sbf1 UTSW 15 89,179,662 (GRCm39) missense probably benign
R8788:Sbf1 UTSW 15 89,186,062 (GRCm39) missense probably damaging 1.00
R9182:Sbf1 UTSW 15 89,173,806 (GRCm39) critical splice donor site probably null
R9516:Sbf1 UTSW 15 89,184,742 (GRCm39) missense probably damaging 1.00
R9608:Sbf1 UTSW 15 89,191,808 (GRCm39) critical splice acceptor site probably null
R9673:Sbf1 UTSW 15 89,179,675 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGCCCAAGGTGTCAAGCAAG -3'
(R):5'- TGGTTTTCTACGGCCACAGC -3'

Sequencing Primer
(F):5'- GGTGTCAAGCAAGCAAGCCC -3'
(R):5'- AGCCCTCTACATCATTGGTGAC -3'
Posted On 2015-10-08