Mutagenetix > Incidental Mutation

Incidental Mutation 'R4666:Epg5'

351984

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

041924-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R4666 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78012864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1751 (N1751S)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably benign
Transcript: ENSMUST00000044622
AA Change: N1751S

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: N1751S

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	G	A	17: 36,978,902	S12L	probably benign	Het
4921507P07Rik	G	T	6: 50,595,828	T35K	possibly damaging	Het
4931406P16Rik	T	C	7: 34,284,773	M142V	probably damaging	Het
Abce1	A	G	8: 79,687,486	V532A	probably damaging	Het
Adamts12	T	A	15: 11,311,492	N1278K	probably benign	Het
Adipor1	T	A	1: 134,424,905	I138N	probably damaging	Het
Aox2	C	T	1: 58,304,597	Q480*	probably null	Het
Arhgef38	C	T	3: 133,140,772		probably null	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Cdh8	T	C	8: 99,024,902	T728A	possibly damaging	Het
Celsr1	A	G	15: 86,030,494	S1093P	probably damaging	Het
Cep135	C	A	5: 76,616,854	P560T	probably benign	Het
Chfr	C	T	5: 110,144,867	Q167*	probably null	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntln	A	G	4: 84,971,216	N312S	probably benign	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col6a6	T	A	9: 105,767,342	Y1249F	possibly damaging	Het
Cpsf2	T	C	12: 101,983,207	S61P	probably damaging	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cryba2	C	T	1: 74,890,048	D179N	probably benign	Het
Daglb	A	T	5: 143,503,349	R654W	probably damaging	Het
Dennd3	A	G	15: 73,570,860	D1244G	probably damaging	Het
Dhx57	T	C	17: 80,274,961	E405G	probably damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dph1	A	G	11: 75,181,330	S238P	probably damaging	Het
Duox1	C	T	2: 122,319,475	P116S	probably benign	Het
Ebf1	A	G	11: 44,991,557	N447D	probably damaging	Het
Exoc6	A	G	19: 37,570,505	D75G	probably damaging	Het
Extl2	T	A	3: 116,024,207	I70N	probably damaging	Het
Fam129c	G	T	8: 71,603,825	E390*	probably null	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fbln7	T	A	2: 128,894,910		probably null	Het
Foxa3	G	T	7: 19,014,372	C275*	probably null	Het
Foxred1	C	T	9: 35,210,855		probably benign	Het
Galr2	A	G	11: 116,283,629	T362A	probably benign	Het
Garem2	C	A	5: 30,114,667	R376S	probably damaging	Het
Gatc	T	A	5: 115,335,547	N111I	probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gm14025	T	C	2: 129,038,230	H592R	probably benign	Het
Gm9894	T	C	13: 67,765,094		noncoding transcript	Het
Gtdc1	T	C	2: 44,591,925	N301S	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtsf1	T	C	15: 103,421,205	I96V	probably benign	Het
Homer1	T	A	13: 93,402,159	I170N	probably damaging	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hoxb9	A	G	11: 96,274,831	K242R	possibly damaging	Het
Ifna14	T	C	4: 88,571,336	R155G	probably benign	Het
Lrrc7	GAAGTTGTTTGGAGATTCTTATCTTA	GA	3: 158,318,408		probably benign	Het
Lsm11	A	G	11: 45,933,813	S296P	probably damaging	Het
Macrod2	T	C	2: 142,217,599	L265P	probably damaging	Het
Mcu	G	A	10: 59,456,699	L53F	probably damaging	Het
Mpv17l2	A	G	8: 70,760,415	V104A	possibly damaging	Het
Myh10	G	A	11: 68,801,730		probably null	Het
Nemf	T	C	12: 69,312,280	E1031G	probably damaging	Het
Nhsl1	G	A	10: 18,531,405	S1395N	probably damaging	Het
Nlrp2	T	A	7: 5,319,189	I82F	probably benign	Het
Nlrp4e	T	A	7: 23,336,780	L686*	probably null	Het
Nudt12os	T	A	17: 59,024,551		noncoding transcript	Het
Olfr1122	T	A	2: 87,387,876	I57K	probably damaging	Het
Olfr16	G	A	1: 172,957,590	S265N	probably benign	Het
Olfr180	T	C	16: 58,916,584	D19G	probably benign	Het
Olfr205	A	G	16: 59,329,210	Y100H	possibly damaging	Het
Olfr93	A	T	17: 37,151,379	S44T	possibly damaging	Het
Olfr944	T	A	9: 39,217,846	M163K	probably damaging	Het
Pde7a	T	C	3: 19,260,256	T59A	probably damaging	Het
Pde7b	A	C	10: 20,438,750	D203E	probably damaging	Het
Phkg2	T	A	7: 127,577,984	I94N	possibly damaging	Het
Pik3r2	G	A	8: 70,768,859	T667I	possibly damaging	Het
Pitx3	T	A	19: 46,137,101	H68L	possibly damaging	Het
Prcd	A	G	11: 116,668,164		probably benign	Het
Prune2	C	T	19: 17,120,188	R1019*	probably null	Het
Psap	A	G	10: 60,300,545	D486G	probably benign	Het
Purb	A	T	11: 6,475,615	V91E	probably damaging	Het
Recql	C	A	6: 142,376,841	V112F	probably damaging	Het
Rptor	A	T	11: 119,743,882	I175F	probably damaging	Het
Sbf1	C	T	15: 89,295,246	V1385M	probably damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Slc35f6	T	C	5: 30,655,613	L37P	probably damaging	Het
Slc6a3	T	A	13: 73,538,581	N22K	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Sp6	C	A	11: 97,021,875	A138E	probably benign	Het
Spag8	G	T	4: 43,653,408		probably benign	Het
Spon1	T	A	7: 114,028,969	M320K	probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmprss11d	T	C	5: 86,309,401	D133G	probably damaging	Het
Trav13n-3	T	A	14: 53,337,496	V65D	probably damaging	Het
Trpm1	G	T	7: 64,203,034	L65F	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ube2v1	T	A	2: 167,610,377	Y102F	probably damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uhrf1bp1	G	T	17: 27,893,503	W1222L	possibly damaging	Het
Vcan	C	A	13: 89,679,934	W2171L	probably damaging	Het
Vmn1r64	T	C	7: 5,884,358	N62S	probably damaging	Het
Vmn2r67	T	C	7: 85,150,623	D469G	probably benign	Het
Vps13b	A	G	15: 35,640,544	S1352G	probably benign	Het
Zbtb38	C	T	9: 96,688,383	R216H	probably damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
R9742:Epg5	UTSW	18	77980955	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCAGGTGTTTGTTAGCGGC -3'
(R):5'- AGAAAGCCTGGGATGTGATC -3'

Sequencing Primer
(F):5'- TGTTAGCGGCACTAAGTCC -3'
(R):5'- CACACTATGTGCAATGAGACTGTC -3'

Posted On

2015-10-08