Mutagenetix > Incidental Mutation

Incidental Mutation 'R4667:Pikfyve'

351989

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

042012-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4667 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65250273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1235 (C1235S)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: C1190S

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: C1190S

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: C1235S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: C1235S

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 109 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	G	T	17: 28,908,313	Q241K	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Adgra3	T	A	5: 49,978,956	Y729F	possibly damaging	Het
Ago2	A	G	15: 73,146,416	Y58H	probably damaging	Het
Akap13	A	G	7: 75,729,094	T2128A	probably damaging	Het
Akap2	A	T	4: 57,855,655	D328V	possibly damaging	Het
Ankhd1	C	A	18: 36,648,021	P2042Q	possibly damaging	Het
Arhgef15	T	C	11: 68,954,561	K155R	probably benign	Het
Atp10b	T	C	11: 43,247,518	F1209L	probably damaging	Het
B130006D01Rik	A	T	11: 95,726,509		probably benign	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Btbd17	A	G	11: 114,793,857	F119L	possibly damaging	Het
Ccdc191	G	T	16: 43,931,283	K267N	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Chd9	T	C	8: 91,033,800	S2058P	possibly damaging	Het
Clcn6	T	C	4: 148,024,167	E135G	possibly damaging	Het
Cntn1	T	A	15: 92,295,079	N687K	probably damaging	Het
Col1a2	A	T	6: 4,512,412	M99L	unknown	Het
Cpeb2	T	C	5: 43,233,892		probably benign	Het
Csn1s2b	A	G	5: 87,822,311	T134A	possibly damaging	Het
Cst13	A	T	2: 148,823,081		probably benign	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
Dhx8	A	G	11: 101,738,161	S179G	unknown	Het
Dip2b	A	G	15: 100,151,360	I212V	probably benign	Het
Dnah9	G	A	11: 66,155,531	H64Y	probably benign	Het
Dnal1	T	C	12: 84,136,700		probably benign	Het
Dse	T	G	10: 34,153,012	Y694S	probably damaging	Het
Dync2h1	T	C	9: 7,051,411	I3175V	probably benign	Het
Elf5	A	G	2: 103,449,060	N209D	probably damaging	Het
Elovl1	A	G	4: 118,430,787	Y40C	probably damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
F5	G	A	1: 164,174,186	V153I	probably benign	Het
Fam186a	G	A	15: 99,944,532	T1277I	possibly damaging	Het
Fam90a1a	A	T	8: 21,963,346	H239L	possibly damaging	Het
Fchsd2	G	T	7: 101,250,449	R334L	probably damaging	Het
Fermt3	T	C	19: 7,002,920	Y369C	probably damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnbp1l	G	T	3: 122,556,567	Q332K	probably benign	Het
Frem3	T	C	8: 80,663,420	S1767P	probably damaging	Het
Ggt5	T	C	10: 75,603,031	L121P	probably damaging	Het
Gm609	A	G	16: 45,444,163	S11P	probably benign	Het
Gphn	T	C	12: 78,454,817	S119P	probably damaging	Het
Herc2	A	G	7: 56,131,253	D1222G	probably damaging	Het
Hmx3	T	C	7: 131,544,382	I273T	possibly damaging	Het
Hnrnpu	A	G	1: 178,332,181		probably benign	Het
Hspg2	C	T	4: 137,539,645	T1987I	possibly damaging	Het
Ighv1-22	T	A	12: 114,746,451	Q58L	probably damaging	Het
Ighv14-3	T	A	12: 114,060,255	I7F	probably benign	Het
Kcns3	C	A	12: 11,091,783	R305L	probably damaging	Het
Kcnu1	C	T	8: 25,910,921	A699V	possibly damaging	Het
Kif22	A	C	7: 127,033,328	L270W	probably damaging	Het
Lrp2	G	T	2: 69,489,298	H1960Q	probably benign	Het
March7	C	T	2: 60,241,050	Q94*	probably null	Het
Mcoln3	A	T	3: 146,131,204	I264F	probably benign	Het
Mdn1	A	C	4: 32,679,572	T706P	probably damaging	Het
Mfsd2b	A	G	12: 4,867,636	C137R	probably benign	Het
Mmp25	A	G	17: 23,644,607	V83A	probably benign	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Mtus2	T	C	5: 148,298,260	S1156P	possibly damaging	Het
Muc5b	G	A	7: 141,842,379	R124H	unknown	Het
Mybbp1a	G	A	11: 72,447,971	E775K	possibly damaging	Het
Myo10	A	G	15: 25,793,153	E1272G	possibly damaging	Het
Nars	A	G	18: 64,505,231	S254P	possibly damaging	Het
Ncapd2	A	G	6: 125,184,518	I211T	possibly damaging	Het
Ncoa7	A	T	10: 30,690,790	W582R	probably damaging	Het
Npr3	T	A	15: 11,905,467	D58V	possibly damaging	Het
Nr3c1	G	T	18: 39,428,727	T430K	probably benign	Het
Odf2l	A	G	3: 145,128,040	T111A	probably benign	Het
Ogdh	G	T	11: 6,340,600	C406F	probably benign	Het
Olfml2a	T	G	2: 38,949,010	S190A	probably damaging	Het
Olfr148	T	C	9: 39,613,738	M57T	probably damaging	Het
Olfr243	A	G	7: 103,716,638	T15A	probably benign	Het
Olfr870	T	C	9: 20,171,098	I158V	probably benign	Het
Olfr965	G	T	9: 39,719,709	V161F	probably benign	Het
Optn	T	C	2: 5,033,139	K415E	probably benign	Het
Perm1	C	A	4: 156,220,206	S803*	probably null	Het
Pex14	T	C	4: 148,984,085	T84A	probably benign	Het
Pih1d2	T	A	9: 50,620,952	Y103*	probably null	Het
Polr1a	A	G	6: 71,917,821	N171S	probably benign	Het
Prrx1	A	G	1: 163,254,047	S201P	probably benign	Het
Psme2b	A	T	11: 48,945,666	N151K	probably benign	Het
Serpinb5	A	T	1: 106,872,295	T72S	probably benign	Het
Sgsm1	A	G	5: 113,260,047		probably null	Het
Sipa1l2	T	C	8: 125,453,470	R1063G	possibly damaging	Het
Slc19a3	T	C	1: 83,022,799	T166A	probably benign	Het
Slc5a4b	T	C	10: 76,075,045	Y319C	possibly damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Sult6b2	G	T	6: 142,801,695	C109*	probably null	Het
Tcf25	A	G	8: 123,397,025	E467G	possibly damaging	Het
Tmem177	A	T	1: 119,910,220	V243D	probably benign	Het
Tmem2	G	A	19: 21,797,351	R119H	probably benign	Het
Tmem2	C	T	19: 21,844,781	A1180V	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Tspan11	T	A	6: 127,943,715	C208*	probably null	Het
Ttc1	A	G	11: 43,745,317	V33A	probably benign	Het
Uck1	T	A	2: 32,256,034	H283L	probably damaging	Het
Utrn	A	C	10: 12,698,053	V1091G	probably benign	Het
Vmn1r11	A	T	6: 57,137,498	H49L	probably damaging	Het
Vmn1r160	G	T	7: 22,872,053	S277I	probably benign	Het
Vmn1r18	A	T	6: 57,390,084	S162T	probably benign	Het
Vps37b	A	G	5: 124,010,732	L80P	probably damaging	Het
Wfdc3	T	C	2: 164,743,086	M1V	probably null	Het
Wrn	A	T	8: 33,324,338	N116K	probably benign	Het
Wscd2	G	T	5: 113,577,272	G391V	probably damaging	Het
Zcchc11	G	A	4: 108,495,159	E357K	probably damaging	Het
Zfp286	A	G	11: 62,780,602	V215A	probably benign	Het
Zfp568	A	G	7: 30,023,277	H549R	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGAGTGCAGCATGTTCTG -3'
(R):5'- AAACCAGCTTTTGTGGATCAAC -3'

Sequencing Primer
(F):5'- GCATGTTCTGCGTCAGTGAC -3'
(R):5'- CAGCTTTTGTGGATCAACTTTGTAAG -3'

Posted On

2015-10-08