Incidental Mutation 'R4667:Lrp2'
ID352000
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Namelow density lipoprotein receptor-related protein 2
SynonymsGp330, D230004K18Rik, b2b1625.2Clo, Megalin
MMRRC Submission 042012-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4667 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69424340-69586065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69489298 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1960 (H1960Q)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
Predicted Effect probably benign
Transcript: ENSMUST00000080953
AA Change: H1960Q

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: H1960Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G T 17: 28,908,313 Q241K possibly damaging Het
Acad8 A G 9: 26,990,627 L147P probably damaging Het
Adgra3 T A 5: 49,978,956 Y729F possibly damaging Het
Ago2 A G 15: 73,146,416 Y58H probably damaging Het
Akap13 A G 7: 75,729,094 T2128A probably damaging Het
Akap2 A T 4: 57,855,655 D328V possibly damaging Het
Ankhd1 C A 18: 36,648,021 P2042Q possibly damaging Het
Arhgef15 T C 11: 68,954,561 K155R probably benign Het
Atp10b T C 11: 43,247,518 F1209L probably damaging Het
B130006D01Rik A T 11: 95,726,509 probably benign Het
Bmpr2 T C 1: 59,867,716 L656S probably damaging Het
Btbd17 A G 11: 114,793,857 F119L possibly damaging Het
Ccdc191 G T 16: 43,931,283 K267N probably damaging Het
Ceacam20 T C 7: 19,986,027 Y495H probably damaging Het
Celf2 T C 2: 6,721,528 I47V probably benign Het
Chd9 T C 8: 91,033,800 S2058P possibly damaging Het
Clcn6 T C 4: 148,024,167 E135G possibly damaging Het
Cntn1 T A 15: 92,295,079 N687K probably damaging Het
Col1a2 A T 6: 4,512,412 M99L unknown Het
Cpeb2 T C 5: 43,233,892 probably benign Het
Csn1s2b A G 5: 87,822,311 T134A possibly damaging Het
Cst13 A T 2: 148,823,081 probably benign Het
Cyp2c66 T A 19: 39,176,656 D360E probably damaging Het
Dhx8 A G 11: 101,738,161 S179G unknown Het
Dip2b A G 15: 100,151,360 I212V probably benign Het
Dnah9 G A 11: 66,155,531 H64Y probably benign Het
Dnal1 T C 12: 84,136,700 probably benign Het
Dse T G 10: 34,153,012 Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 I3175V probably benign Het
Elf5 A G 2: 103,449,060 N209D probably damaging Het
Elovl1 A G 4: 118,430,787 Y40C probably damaging Het
Erp27 T C 6: 136,908,152 E216G possibly damaging Het
F5 G A 1: 164,174,186 V153I probably benign Het
Fam186a G A 15: 99,944,532 T1277I possibly damaging Het
Fam90a1a A T 8: 21,963,346 H239L possibly damaging Het
Fchsd2 G T 7: 101,250,449 R334L probably damaging Het
Fermt3 T C 19: 7,002,920 Y369C probably damaging Het
Fhod3 C T 18: 25,066,338 P689S probably benign Het
Fnbp1l G T 3: 122,556,567 Q332K probably benign Het
Frem3 T C 8: 80,663,420 S1767P probably damaging Het
Ggt5 T C 10: 75,603,031 L121P probably damaging Het
Gm609 A G 16: 45,444,163 S11P probably benign Het
Gphn T C 12: 78,454,817 S119P probably damaging Het
Herc2 A G 7: 56,131,253 D1222G probably damaging Het
Hmx3 T C 7: 131,544,382 I273T possibly damaging Het
Hnrnpu A G 1: 178,332,181 probably benign Het
Hspg2 C T 4: 137,539,645 T1987I possibly damaging Het
Ighv1-22 T A 12: 114,746,451 Q58L probably damaging Het
Ighv14-3 T A 12: 114,060,255 I7F probably benign Het
Kcns3 C A 12: 11,091,783 R305L probably damaging Het
Kcnu1 C T 8: 25,910,921 A699V possibly damaging Het
Kif22 A C 7: 127,033,328 L270W probably damaging Het
March7 C T 2: 60,241,050 Q94* probably null Het
Mcoln3 A T 3: 146,131,204 I264F probably benign Het
Mdn1 A C 4: 32,679,572 T706P probably damaging Het
Mfsd2b A G 12: 4,867,636 C137R probably benign Het
Mmp25 A G 17: 23,644,607 V83A probably benign Het
Mocos T C 18: 24,666,434 Y242H probably benign Het
Msh6 T C 17: 87,984,806 S330P possibly damaging Het
Mtus2 T C 5: 148,298,260 S1156P possibly damaging Het
Muc5b G A 7: 141,842,379 R124H unknown Het
Mybbp1a G A 11: 72,447,971 E775K possibly damaging Het
Myo10 A G 15: 25,793,153 E1272G possibly damaging Het
Nars A G 18: 64,505,231 S254P possibly damaging Het
Ncapd2 A G 6: 125,184,518 I211T possibly damaging Het
Ncoa7 A T 10: 30,690,790 W582R probably damaging Het
Npr3 T A 15: 11,905,467 D58V possibly damaging Het
Nr3c1 G T 18: 39,428,727 T430K probably benign Het
Odf2l A G 3: 145,128,040 T111A probably benign Het
Ogdh G T 11: 6,340,600 C406F probably benign Het
Olfml2a T G 2: 38,949,010 S190A probably damaging Het
Olfr148 T C 9: 39,613,738 M57T probably damaging Het
Olfr243 A G 7: 103,716,638 T15A probably benign Het
Olfr870 T C 9: 20,171,098 I158V probably benign Het
Olfr965 G T 9: 39,719,709 V161F probably benign Het
Optn T C 2: 5,033,139 K415E probably benign Het
Perm1 C A 4: 156,220,206 S803* probably null Het
Pex14 T C 4: 148,984,085 T84A probably benign Het
Pih1d2 T A 9: 50,620,952 Y103* probably null Het
Pikfyve T A 1: 65,250,273 C1235S probably damaging Het
Polr1a A G 6: 71,917,821 N171S probably benign Het
Prrx1 A G 1: 163,254,047 S201P probably benign Het
Psme2b A T 11: 48,945,666 N151K probably benign Het
Serpinb5 A T 1: 106,872,295 T72S probably benign Het
Sgsm1 A G 5: 113,260,047 probably null Het
Sipa1l2 T C 8: 125,453,470 R1063G possibly damaging Het
Slc19a3 T C 1: 83,022,799 T166A probably benign Het
Slc5a4b T C 10: 76,075,045 Y319C possibly damaging Het
Stard3nl T A 13: 19,376,519 N29Y probably damaging Het
Sult6b2 G T 6: 142,801,695 C109* probably null Het
Tcf25 A G 8: 123,397,025 E467G possibly damaging Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Tmem2 G A 19: 21,797,351 R119H probably benign Het
Tmem2 C T 19: 21,844,781 A1180V probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tspan11 T A 6: 127,943,715 C208* probably null Het
Ttc1 A G 11: 43,745,317 V33A probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Utrn A C 10: 12,698,053 V1091G probably benign Het
Vmn1r11 A T 6: 57,137,498 H49L probably damaging Het
Vmn1r160 G T 7: 22,872,053 S277I probably benign Het
Vmn1r18 A T 6: 57,390,084 S162T probably benign Het
Vps37b A G 5: 124,010,732 L80P probably damaging Het
Wfdc3 T C 2: 164,743,086 M1V probably null Het
Wrn A T 8: 33,324,338 N116K probably benign Het
Wscd2 G T 5: 113,577,272 G391V probably damaging Het
Zcchc11 G A 4: 108,495,159 E357K probably damaging Het
Zfp286 A G 11: 62,780,602 V215A probably benign Het
Zfp568 A G 7: 30,023,277 H549R probably damaging Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
Presto UTSW 2 69459531 nonsense probably null
relaxed UTSW 2 69535005 missense probably damaging 1.00
Unintended UTSW 2 69518443 missense probably damaging 1.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0544:Lrp2 UTSW 2 69491931 missense probably benign 0.18
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 unclassified probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69459715 missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69499263 missense probably benign
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
R7150:Lrp2 UTSW 2 69488051 missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69506573 missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69433072 missense probably benign 0.11
R7204:Lrp2 UTSW 2 69472533 missense probably benign 0.25
R7275:Lrp2 UTSW 2 69459531 nonsense probably null
R7278:Lrp2 UTSW 2 69486352 missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69482381 missense probably benign 0.04
R7315:Lrp2 UTSW 2 69491822 missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69479290 missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69448142 missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69472397 missense probably benign 0.04
R7366:Lrp2 UTSW 2 69483806 missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69500692 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69432213 missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69459674 missense probably damaging 0.99
R7451:Lrp2 UTSW 2 69513333 missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69537581 missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69516403 missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69477008 critical splice donor site probably null
R7664:Lrp2 UTSW 2 69506732 missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69489237 missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69479343 critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69496438 missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69503388 missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69501539 missense possibly damaging 0.74
RF016:Lrp2 UTSW 2 69509205 missense probably benign
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGACTACACATCACACGTG -3'
(R):5'- GTTCAGTGAACTCCAGATGGAC -3'

Sequencing Primer
(F):5'- CGTGACAAGTACTCACTGCGATG -3'
(R):5'- GGACCCATTCCATAACAGGTCTGAG -3'
Posted On2015-10-08