Incidental Mutation 'R4667:Mdn1'
ID 352008
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, D4Abb1e, LOC213784
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 32679572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Proline at position 706 (T706P)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071642
AA Change: T706P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: T706P

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133403
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: T706P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: T706P

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm39) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm39) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm39) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm39) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm39) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm39) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm39) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm39) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm39) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm39) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm39) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm39) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm39) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm39) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm39) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm39) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm39) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm39) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm39) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm39) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm39) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm39) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm39) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm39) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm39) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm39) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm39) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm39) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm39) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm39) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm39) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm39) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm39) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm39) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm39) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm39) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm39) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm39) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm39) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm39) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm39) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm39) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm39) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm39) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm39) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm39) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm39) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm39) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm39) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm39) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm39) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm39) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm39) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm39) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm39) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm39) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm39) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm39) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm39) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm39) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm39) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm39) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm39) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm39) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm39) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm39) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm39) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm39) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm39) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm39) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm39) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm39) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm39) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm39) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm39) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm39) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm39) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm39) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm39) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm39) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm39) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm39) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm39) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm39) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm39) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm39) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm39) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm39) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm39) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm39) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm39) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm39) splice site probably null
R4684:Mdn1 UTSW 4 32,666,430 (GRCm39) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm39) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm39) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm39) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm39) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm39) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm39) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm39) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm39) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm39) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm39) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm39) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm39) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm39) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm39) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm39) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm39) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm39) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm39) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm39) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm39) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm39) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm39) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm39) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm39) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm39) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm39) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm39) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm39) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm39) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm39) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm39) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm39) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm39) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm39) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm39) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm39) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm39) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm39) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm39) missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32,676,786 (GRCm39) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm39) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm39) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm39) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm39) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm39) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm39) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm39) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm39) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm39) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm39) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm39) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm39) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm39) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm39) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm39) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm39) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm39) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm39) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm39) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm39) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm39) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm39) missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm39) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm39) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm39) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm39) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm39) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm39) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm39) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm39) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm39) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm39) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm39) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm39) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm39) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm39) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm39) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm39) missense probably damaging 1.00
R8708:Mdn1 UTSW 4 32,725,854 (GRCm39) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm39) missense probably damaging 0.97
R8896:Mdn1 UTSW 4 32,678,328 (GRCm39) missense probably benign 0.28
R8918:Mdn1 UTSW 4 32,744,579 (GRCm39) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm39) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm39) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm39) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm39) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm39) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm39) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm39) missense probably benign 0.00
R9226:Mdn1 UTSW 4 32,694,612 (GRCm39) missense probably benign 0.25
R9235:Mdn1 UTSW 4 32,739,122 (GRCm39) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm39) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm39) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm39) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm39) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm39) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm39) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm39) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm39) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm39) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm39) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm39) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAACTTGCCTGCCTTCTTAAG -3'
(R):5'- CCCACTGCTGTTATCAGGC -3'

Sequencing Primer
(F):5'- CTTAAGGAATACATTGTGAGCTTTTG -3'
(R):5'- GGTCTATAGTTAGCTCCAGACCAG -3'
Posted On 2015-10-08