Incidental Mutation 'R4667:Perm1'
ID 352015
Institutional Source Beutler Lab
Gene Symbol Perm1
Ensembl Gene ENSMUSG00000078486
Gene Name PPARGC1 and ESRR induced regulator, muscle 1
Synonyms 2310042D19Rik
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 156300325-156305764 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 156304663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 803 (S803*)
Ref Sequence ENSEMBL: ENSMUSP00000101197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
AlphaFold Q149B8
Predicted Effect probably benign
Transcript: ENSMUST00000105571
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105572
AA Change: S803*
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486
AA Change: S803*

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217885
Predicted Effect probably benign
Transcript: ENSMUST00000218699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219227
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Perm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Perm1 APN 4 156,302,118 (GRCm39) missense probably damaging 0.99
IGL01970:Perm1 APN 4 156,302,118 (GRCm39) missense probably damaging 0.99
IGL02143:Perm1 APN 4 156,302,500 (GRCm39) missense probably benign 0.09
IGL02644:Perm1 APN 4 156,303,043 (GRCm39) missense probably damaging 1.00
IGL02993:Perm1 APN 4 156,302,236 (GRCm39) missense probably benign 0.20
PIT4366001:Perm1 UTSW 4 156,303,192 (GRCm39) missense probably benign 0.11
R0052:Perm1 UTSW 4 156,302,572 (GRCm39) missense probably damaging 1.00
R0105:Perm1 UTSW 4 156,302,682 (GRCm39) missense probably benign 0.23
R0566:Perm1 UTSW 4 156,302,316 (GRCm39) missense probably benign 0.10
R1184:Perm1 UTSW 4 156,301,771 (GRCm39) missense probably damaging 1.00
R1208:Perm1 UTSW 4 156,301,459 (GRCm39) start codon destroyed probably null 0.92
R1244:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R1724:Perm1 UTSW 4 156,302,529 (GRCm39) missense possibly damaging 0.82
R1783:Perm1 UTSW 4 156,302,988 (GRCm39) nonsense probably null
R1817:Perm1 UTSW 4 156,303,061 (GRCm39) missense possibly damaging 0.59
R1892:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R1893:Perm1 UTSW 4 156,302,340 (GRCm39) missense probably benign 0.09
R2106:Perm1 UTSW 4 156,303,336 (GRCm39) missense probably damaging 1.00
R2567:Perm1 UTSW 4 156,301,575 (GRCm39) missense probably damaging 0.99
R3752:Perm1 UTSW 4 156,302,403 (GRCm39) missense probably benign 0.01
R3934:Perm1 UTSW 4 156,303,627 (GRCm39) missense probably benign
R4509:Perm1 UTSW 4 156,302,043 (GRCm39) missense probably benign 0.02
R4706:Perm1 UTSW 4 156,301,531 (GRCm39) missense probably damaging 0.99
R4812:Perm1 UTSW 4 156,303,193 (GRCm39) missense possibly damaging 0.59
R4979:Perm1 UTSW 4 156,302,034 (GRCm39) missense probably benign 0.01
R5275:Perm1 UTSW 4 156,301,975 (GRCm39) missense probably benign
R5295:Perm1 UTSW 4 156,301,975 (GRCm39) missense probably benign
R5425:Perm1 UTSW 4 156,302,752 (GRCm39) missense probably benign 0.04
R6125:Perm1 UTSW 4 156,302,176 (GRCm39) missense probably benign 0.00
R6573:Perm1 UTSW 4 156,303,130 (GRCm39) missense probably damaging 1.00
R6721:Perm1 UTSW 4 156,302,776 (GRCm39) missense probably benign 0.00
R6986:Perm1 UTSW 4 156,302,976 (GRCm39) nonsense probably null
R7190:Perm1 UTSW 4 156,304,272 (GRCm39) missense possibly damaging 0.84
R7561:Perm1 UTSW 4 156,303,217 (GRCm39) missense probably benign
R7578:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7769:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7876:Perm1 UTSW 4 156,302,046 (GRCm39) missense probably damaging 0.98
R7899:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R7943:Perm1 UTSW 4 156,302,991 (GRCm39) missense probably damaging 0.98
R7979:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8217:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8352:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8680:Perm1 UTSW 4 156,302,091 (GRCm39) missense probably benign
R8719:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8753:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R8847:Perm1 UTSW 4 156,302,068 (GRCm39) missense probably benign
R9170:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9231:Perm1 UTSW 4 156,302,234 (GRCm39) missense probably damaging 0.98
R9255:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9259:Perm1 UTSW 4 156,303,607 (GRCm39) missense probably benign 0.33
R9410:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9465:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9492:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9501:Perm1 UTSW 4 156,302,177 (GRCm39) missense probably benign 0.32
R9518:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
R9548:Perm1 UTSW 4 156,302,290 (GRCm39) missense probably benign 0.02
R9569:Perm1 UTSW 4 156,303,039 (GRCm39) missense probably benign 0.13
R9576:Perm1 UTSW 4 156,302,525 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACTGTCCTTTGAAGACTGCG -3'
(R):5'- TTCAGGTATGGAAAATGCCCTTG -3'

Sequencing Primer
(F):5'- CGTTGTGCAGGCAGAAGTC -3'
(R):5'- AGTCAGTGACTGGACCCTTAG -3'
Posted On 2015-10-08