Incidental Mutation 'R4667:Herc2'
ID 352034
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene Name HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms D7H15F32S1, D7H15F37S1, D15F32S1h, rjs, jdf2
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 55699944-55881548 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55781001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1222 (D1222G)
Ref Sequence ENSEMBL: ENSMUSP00000145997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076226
AA Change: D1222G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: D1222G

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164095
AA Change: D1222G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: D1222G

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205303
AA Change: D1222G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Akap13 A G 7: 75,378,842 (GRCm39) T2128A probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 55,774,047 (GRCm39) missense probably damaging 1.00
IGL00529:Herc2 APN 7 55,807,501 (GRCm39) missense probably benign
IGL00548:Herc2 APN 7 55,856,313 (GRCm39) missense probably benign 0.20
IGL00970:Herc2 APN 7 55,830,812 (GRCm39) splice site probably benign
IGL01141:Herc2 APN 7 55,862,589 (GRCm39) missense possibly damaging 0.47
IGL01147:Herc2 APN 7 55,806,697 (GRCm39) missense probably benign 0.43
IGL01150:Herc2 APN 7 55,830,881 (GRCm39) missense probably damaging 1.00
IGL01519:Herc2 APN 7 55,753,698 (GRCm39) missense probably damaging 1.00
IGL01576:Herc2 APN 7 55,876,409 (GRCm39) critical splice donor site probably null
IGL01626:Herc2 APN 7 55,734,890 (GRCm39) missense probably benign 0.02
IGL01658:Herc2 APN 7 55,809,200 (GRCm39) missense probably damaging 1.00
IGL01707:Herc2 APN 7 55,814,935 (GRCm39) missense probably damaging 1.00
IGL01727:Herc2 APN 7 55,787,554 (GRCm39) missense probably damaging 1.00
IGL01935:Herc2 APN 7 55,803,541 (GRCm39) missense probably benign
IGL01969:Herc2 APN 7 55,835,579 (GRCm39) splice site probably benign
IGL02074:Herc2 APN 7 55,737,192 (GRCm39) splice site probably benign
IGL02261:Herc2 APN 7 55,856,492 (GRCm39) missense probably damaging 0.99
IGL02339:Herc2 APN 7 55,771,470 (GRCm39) missense probably benign 0.01
IGL02353:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02360:Herc2 APN 7 55,764,560 (GRCm39) missense probably damaging 1.00
IGL02409:Herc2 APN 7 55,870,217 (GRCm39) splice site probably null
IGL02528:Herc2 APN 7 55,758,641 (GRCm39) splice site probably benign
IGL02571:Herc2 APN 7 55,803,134 (GRCm39) missense probably damaging 1.00
IGL02578:Herc2 APN 7 55,756,283 (GRCm39) splice site probably null
IGL02661:Herc2 APN 7 55,762,821 (GRCm39) missense probably damaging 1.00
IGL02664:Herc2 APN 7 55,785,426 (GRCm39) nonsense probably null
IGL02675:Herc2 APN 7 55,813,849 (GRCm39) missense probably damaging 0.99
IGL02689:Herc2 APN 7 55,815,031 (GRCm39) splice site probably benign
IGL02710:Herc2 APN 7 55,787,562 (GRCm39) missense possibly damaging 0.95
IGL02750:Herc2 APN 7 55,854,127 (GRCm39) splice site probably benign
IGL02754:Herc2 APN 7 55,747,246 (GRCm39) missense probably damaging 1.00
IGL03029:Herc2 APN 7 55,818,715 (GRCm39) missense probably damaging 1.00
IGL03039:Herc2 APN 7 55,818,769 (GRCm39) splice site probably benign
IGL03082:Herc2 APN 7 55,835,671 (GRCm39) missense probably benign 0.19
IGL03090:Herc2 APN 7 55,854,221 (GRCm39) missense probably damaging 0.96
IGL03154:Herc2 APN 7 55,851,907 (GRCm39) missense probably damaging 1.00
IGL03165:Herc2 APN 7 55,841,660 (GRCm39) missense probably damaging 1.00
IGL03201:Herc2 APN 7 55,869,516 (GRCm39) missense probably damaging 1.00
IGL03234:Herc2 APN 7 55,753,610 (GRCm39) missense probably damaging 1.00
IGL03293:Herc2 APN 7 55,804,878 (GRCm39) missense probably benign 0.43
IGL03331:Herc2 APN 7 55,785,015 (GRCm39) splice site probably benign
IGL03340:Herc2 APN 7 55,740,668 (GRCm39) missense possibly damaging 0.51
IGL03409:Herc2 APN 7 55,878,317 (GRCm39) missense probably damaging 1.00
alarmed UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
hyper UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0798_herc2_487 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R1370_Herc2_948 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R2030_Herc2_144 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
uptight UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
I0000:Herc2 UTSW 7 55,786,477 (GRCm39) splice site probably benign
PIT1430001:Herc2 UTSW 7 55,876,702 (GRCm39) missense probably damaging 1.00
R0009:Herc2 UTSW 7 55,857,560 (GRCm39) missense probably benign 0.03
R0009:Herc2 UTSW 7 55,857,560 (GRCm39) missense probably benign 0.03
R0058:Herc2 UTSW 7 55,820,231 (GRCm39) missense possibly damaging 0.93
R0114:Herc2 UTSW 7 55,803,522 (GRCm39) splice site probably benign
R0117:Herc2 UTSW 7 55,863,359 (GRCm39) splice site probably benign
R0141:Herc2 UTSW 7 55,771,309 (GRCm39) missense probably benign 0.17
R0266:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0401:Herc2 UTSW 7 55,807,480 (GRCm39) missense probably damaging 0.99
R0403:Herc2 UTSW 7 55,809,165 (GRCm39) missense probably damaging 1.00
R0437:Herc2 UTSW 7 55,869,563 (GRCm39) nonsense probably null
R0491:Herc2 UTSW 7 55,772,114 (GRCm39) missense possibly damaging 0.54
R0499:Herc2 UTSW 7 55,834,117 (GRCm39) nonsense probably null
R0580:Herc2 UTSW 7 55,788,539 (GRCm39) missense probably damaging 1.00
R0650:Herc2 UTSW 7 55,762,958 (GRCm39) missense probably damaging 1.00
R0744:Herc2 UTSW 7 55,855,784 (GRCm39) splice site probably benign
R0798:Herc2 UTSW 7 55,785,431 (GRCm39) critical splice donor site probably null
R0842:Herc2 UTSW 7 55,771,453 (GRCm39) missense probably benign
R0849:Herc2 UTSW 7 55,856,326 (GRCm39) missense probably damaging 1.00
R0850:Herc2 UTSW 7 55,854,231 (GRCm39) missense probably benign 0.09
R0926:Herc2 UTSW 7 55,782,296 (GRCm39) missense possibly damaging 0.67
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1146:Herc2 UTSW 7 55,796,444 (GRCm39) missense probably benign
R1292:Herc2 UTSW 7 55,846,951 (GRCm39) missense probably benign 0.05
R1370:Herc2 UTSW 7 55,818,621 (GRCm39) missense probably benign 0.01
R1443:Herc2 UTSW 7 55,854,481 (GRCm39) missense possibly damaging 0.69
R1445:Herc2 UTSW 7 55,818,744 (GRCm39) missense probably damaging 1.00
R1541:Herc2 UTSW 7 55,785,405 (GRCm39) missense probably damaging 1.00
R1550:Herc2 UTSW 7 55,785,406 (GRCm39) missense probably damaging 1.00
R1551:Herc2 UTSW 7 55,796,417 (GRCm39) missense probably benign 0.01
R1633:Herc2 UTSW 7 55,879,117 (GRCm39) missense probably null 1.00
R1635:Herc2 UTSW 7 55,786,415 (GRCm39) missense probably benign 0.00
R1659:Herc2 UTSW 7 55,784,853 (GRCm39) missense probably benign 0.00
R1682:Herc2 UTSW 7 55,738,148 (GRCm39) missense possibly damaging 0.87
R1697:Herc2 UTSW 7 55,803,653 (GRCm39) missense probably benign 0.43
R1748:Herc2 UTSW 7 55,798,571 (GRCm39) critical splice donor site probably null
R1802:Herc2 UTSW 7 55,834,080 (GRCm39) missense probably damaging 1.00
R1835:Herc2 UTSW 7 55,856,513 (GRCm39) nonsense probably null
R1836:Herc2 UTSW 7 55,804,853 (GRCm39) nonsense probably null
R1872:Herc2 UTSW 7 55,807,257 (GRCm39) missense probably benign 0.18
R1889:Herc2 UTSW 7 55,839,561 (GRCm39) missense possibly damaging 0.60
R1906:Herc2 UTSW 7 55,764,612 (GRCm39) missense probably benign 0.01
R2004:Herc2 UTSW 7 55,787,607 (GRCm39) missense probably damaging 1.00
R2030:Herc2 UTSW 7 55,834,121 (GRCm39) missense probably damaging 0.99
R2037:Herc2 UTSW 7 55,855,709 (GRCm39) missense probably damaging 1.00
R2059:Herc2 UTSW 7 55,813,645 (GRCm39) missense probably damaging 1.00
R2068:Herc2 UTSW 7 55,782,245 (GRCm39) missense probably damaging 1.00
R2072:Herc2 UTSW 7 55,876,712 (GRCm39) missense probably damaging 1.00
R2085:Herc2 UTSW 7 55,862,713 (GRCm39) missense possibly damaging 0.94
R2115:Herc2 UTSW 7 55,835,576 (GRCm39) splice site probably benign
R2160:Herc2 UTSW 7 55,862,670 (GRCm39) missense probably benign 0.00
R2173:Herc2 UTSW 7 55,835,699 (GRCm39) missense probably benign 0.27
R2221:Herc2 UTSW 7 55,818,766 (GRCm39) critical splice donor site probably null
R2280:Herc2 UTSW 7 55,787,019 (GRCm39) missense possibly damaging 0.79
R3078:Herc2 UTSW 7 55,786,991 (GRCm39) missense probably benign
R3104:Herc2 UTSW 7 55,785,103 (GRCm39) missense probably benign 0.23
R3177:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3277:Herc2 UTSW 7 55,803,176 (GRCm39) missense probably benign 0.00
R3766:Herc2 UTSW 7 55,813,572 (GRCm39) missense probably damaging 1.00
R3770:Herc2 UTSW 7 55,814,755 (GRCm39) missense probably benign
R3807:Herc2 UTSW 7 55,857,557 (GRCm39) missense probably damaging 1.00
R3912:Herc2 UTSW 7 55,748,185 (GRCm39) missense probably damaging 0.98
R4004:Herc2 UTSW 7 55,756,213 (GRCm39) missense possibly damaging 0.53
R4039:Herc2 UTSW 7 55,806,159 (GRCm39) missense probably damaging 0.98
R4190:Herc2 UTSW 7 55,772,196 (GRCm39) missense probably benign 0.03
R4225:Herc2 UTSW 7 55,814,735 (GRCm39) missense probably damaging 1.00
R4334:Herc2 UTSW 7 55,876,402 (GRCm39) missense probably damaging 1.00
R4405:Herc2 UTSW 7 55,820,225 (GRCm39) missense probably damaging 1.00
R4448:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4450:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4565:Herc2 UTSW 7 55,803,586 (GRCm39) missense possibly damaging 0.71
R4747:Herc2 UTSW 7 55,756,141 (GRCm39) missense possibly damaging 0.80
R4762:Herc2 UTSW 7 55,820,388 (GRCm39) missense probably benign 0.19
R4829:Herc2 UTSW 7 55,756,240 (GRCm39) missense probably benign 0.39
R4832:Herc2 UTSW 7 55,748,165 (GRCm39) nonsense probably null
R4895:Herc2 UTSW 7 55,872,734 (GRCm39) missense probably damaging 1.00
R4904:Herc2 UTSW 7 55,807,234 (GRCm39) missense probably damaging 0.99
R4908:Herc2 UTSW 7 55,827,660 (GRCm39) missense probably benign 0.01
R4911:Herc2 UTSW 7 55,877,640 (GRCm39) missense probably damaging 1.00
R4921:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
R4939:Herc2 UTSW 7 55,856,484 (GRCm39) missense probably damaging 1.00
R5155:Herc2 UTSW 7 55,877,574 (GRCm39) missense possibly damaging 0.85
R5184:Herc2 UTSW 7 55,772,099 (GRCm39) missense probably damaging 1.00
R5269:Herc2 UTSW 7 55,818,618 (GRCm39) nonsense probably null
R5306:Herc2 UTSW 7 55,834,709 (GRCm39) missense probably damaging 1.00
R5314:Herc2 UTSW 7 55,869,534 (GRCm39) missense probably damaging 0.99
R5369:Herc2 UTSW 7 55,832,448 (GRCm39) missense probably damaging 1.00
R5418:Herc2 UTSW 7 55,787,313 (GRCm39) missense probably damaging 1.00
R5420:Herc2 UTSW 7 55,853,578 (GRCm39) missense probably damaging 0.96
R5463:Herc2 UTSW 7 55,844,010 (GRCm39) missense probably damaging 1.00
R5510:Herc2 UTSW 7 55,856,519 (GRCm39) missense probably damaging 1.00
R5634:Herc2 UTSW 7 55,856,531 (GRCm39) missense probably damaging 1.00
R5638:Herc2 UTSW 7 55,854,164 (GRCm39) missense probably benign 0.01
R5690:Herc2 UTSW 7 55,807,453 (GRCm39) missense probably benign
R5762:Herc2 UTSW 7 55,846,938 (GRCm39) missense possibly damaging 0.68
R5807:Herc2 UTSW 7 55,880,667 (GRCm39) missense probably damaging 0.99
R5878:Herc2 UTSW 7 55,773,996 (GRCm39) missense probably benign
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6036:Herc2 UTSW 7 55,717,801 (GRCm39) missense probably benign 0.01
R6083:Herc2 UTSW 7 55,878,253 (GRCm39) missense probably benign 0.00
R6192:Herc2 UTSW 7 55,857,510 (GRCm39) missense probably damaging 1.00
R6193:Herc2 UTSW 7 55,806,649 (GRCm39) missense probably damaging 0.98
R6261:Herc2 UTSW 7 55,846,820 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,802,914 (GRCm39) nonsense probably null
R6267:Herc2 UTSW 7 55,854,466 (GRCm39) missense possibly damaging 0.51
R6298:Herc2 UTSW 7 55,841,013 (GRCm39) missense probably benign
R6299:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R6326:Herc2 UTSW 7 55,872,682 (GRCm39) missense probably damaging 0.98
R6347:Herc2 UTSW 7 55,844,151 (GRCm39) critical splice donor site probably null
R6394:Herc2 UTSW 7 55,865,729 (GRCm39) missense probably damaging 1.00
R6500:Herc2 UTSW 7 55,796,393 (GRCm39) nonsense probably null
R6526:Herc2 UTSW 7 55,807,078 (GRCm39) missense probably damaging 0.99
R6592:Herc2 UTSW 7 55,857,438 (GRCm39) critical splice acceptor site probably null
R6619:Herc2 UTSW 7 55,717,840 (GRCm39) nonsense probably null
R6719:Herc2 UTSW 7 55,862,574 (GRCm39) missense probably damaging 1.00
R6750:Herc2 UTSW 7 55,747,195 (GRCm39) missense probably damaging 1.00
R6807:Herc2 UTSW 7 55,814,670 (GRCm39) missense probably damaging 1.00
R6811:Herc2 UTSW 7 55,763,181 (GRCm39) nonsense probably null
R6837:Herc2 UTSW 7 55,839,589 (GRCm39) missense possibly damaging 0.89
R6838:Herc2 UTSW 7 55,758,526 (GRCm39) missense probably damaging 1.00
R6902:Herc2 UTSW 7 55,785,234 (GRCm39) missense probably benign 0.37
R6983:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6985:Herc2 UTSW 7 55,782,228 (GRCm39) missense probably damaging 1.00
R6985:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6986:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R6987:Herc2 UTSW 7 55,756,201 (GRCm39) missense possibly damaging 0.74
R7113:Herc2 UTSW 7 55,853,597 (GRCm39) missense probably damaging 0.99
R7173:Herc2 UTSW 7 55,853,575 (GRCm39) missense probably damaging 1.00
R7202:Herc2 UTSW 7 55,781,034 (GRCm39) missense probably damaging 0.99
R7205:Herc2 UTSW 7 55,832,388 (GRCm39) missense probably damaging 1.00
R7236:Herc2 UTSW 7 55,734,828 (GRCm39) missense probably benign 0.29
R7297:Herc2 UTSW 7 55,786,406 (GRCm39) missense probably benign 0.00
R7358:Herc2 UTSW 7 55,832,423 (GRCm39) missense possibly damaging 0.48
R7438:Herc2 UTSW 7 55,753,466 (GRCm39) splice site probably null
R7537:Herc2 UTSW 7 55,869,527 (GRCm39) nonsense probably null
R7578:Herc2 UTSW 7 55,784,548 (GRCm39) missense probably benign 0.07
R7614:Herc2 UTSW 7 55,803,023 (GRCm39) nonsense probably null
R7638:Herc2 UTSW 7 55,807,186 (GRCm39) missense probably benign 0.26
R7638:Herc2 UTSW 7 55,870,273 (GRCm39) missense probably damaging 1.00
R7646:Herc2 UTSW 7 55,784,361 (GRCm39) missense probably benign
R7663:Herc2 UTSW 7 55,786,433 (GRCm39) missense probably benign
R7665:Herc2 UTSW 7 55,802,903 (GRCm39) missense probably damaging 1.00
R7691:Herc2 UTSW 7 55,841,593 (GRCm39) missense probably benign
R7733:Herc2 UTSW 7 55,838,412 (GRCm39) missense probably damaging 0.99
R7767:Herc2 UTSW 7 55,878,275 (GRCm39) missense probably benign 0.39
R7802:Herc2 UTSW 7 55,813,838 (GRCm39) missense probably damaging 1.00
R7847:Herc2 UTSW 7 55,807,308 (GRCm39) critical splice donor site probably null
R7956:Herc2 UTSW 7 55,763,148 (GRCm39) missense probably damaging 0.97
R7985:Herc2 UTSW 7 55,814,992 (GRCm39) missense probably benign
R8003:Herc2 UTSW 7 55,818,652 (GRCm39) missense possibly damaging 0.94
R8045:Herc2 UTSW 7 55,834,648 (GRCm39) missense probably damaging 1.00
R8085:Herc2 UTSW 7 55,879,427 (GRCm39) missense probably benign 0.01
R8134:Herc2 UTSW 7 55,734,884 (GRCm39) missense probably benign 0.10
R8259:Herc2 UTSW 7 55,855,638 (GRCm39) missense probably damaging 0.99
R8286:Herc2 UTSW 7 55,879,410 (GRCm39) missense possibly damaging 0.92
R8304:Herc2 UTSW 7 55,809,186 (GRCm39) missense probably damaging 1.00
R8321:Herc2 UTSW 7 55,879,096 (GRCm39) missense possibly damaging 0.84
R8332:Herc2 UTSW 7 55,796,343 (GRCm39) missense probably damaging 1.00
R8432:Herc2 UTSW 7 55,804,860 (GRCm39) missense probably benign 0.14
R8516:Herc2 UTSW 7 55,856,318 (GRCm39) missense probably benign 0.05
R8676:Herc2 UTSW 7 55,838,361 (GRCm39) missense probably damaging 1.00
R8738:Herc2 UTSW 7 55,798,402 (GRCm39) missense possibly damaging 0.78
R8742:Herc2 UTSW 7 55,744,143 (GRCm39) missense probably benign 0.12
R8796:Herc2 UTSW 7 55,785,123 (GRCm39) missense probably benign 0.01
R8825:Herc2 UTSW 7 55,700,626 (GRCm39) start codon destroyed probably null 0.01
R8826:Herc2 UTSW 7 55,756,144 (GRCm39) missense probably benign 0.12
R8842:Herc2 UTSW 7 55,738,059 (GRCm39) missense probably damaging 0.99
R9103:Herc2 UTSW 7 55,784,803 (GRCm39) missense possibly damaging 0.47
R9124:Herc2 UTSW 7 55,834,056 (GRCm39) missense probably damaging 1.00
R9134:Herc2 UTSW 7 55,832,177 (GRCm39) missense probably damaging 0.99
R9168:Herc2 UTSW 7 55,802,208 (GRCm39) missense probably damaging 0.99
R9173:Herc2 UTSW 7 55,856,350 (GRCm39) missense probably damaging 0.97
R9238:Herc2 UTSW 7 55,813,508 (GRCm39) missense probably damaging 0.98
R9249:Herc2 UTSW 7 55,762,890 (GRCm39) missense probably damaging 1.00
R9344:Herc2 UTSW 7 55,772,112 (GRCm39) missense probably benign 0.07
R9432:Herc2 UTSW 7 55,780,932 (GRCm39) missense probably damaging 1.00
R9472:Herc2 UTSW 7 55,813,843 (GRCm39) missense probably damaging 1.00
R9513:Herc2 UTSW 7 55,762,848 (GRCm39) missense probably damaging 1.00
R9579:Herc2 UTSW 7 55,758,500 (GRCm39) missense probably damaging 0.99
R9596:Herc2 UTSW 7 55,834,595 (GRCm39) missense
R9664:Herc2 UTSW 7 55,820,338 (GRCm39) missense possibly damaging 0.90
R9760:Herc2 UTSW 7 55,813,659 (GRCm39) critical splice donor site probably null
R9781:Herc2 UTSW 7 55,750,096 (GRCm39) missense possibly damaging 0.53
RF024:Herc2 UTSW 7 55,876,273 (GRCm39) missense probably damaging 1.00
X0011:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
X0023:Herc2 UTSW 7 55,740,666 (GRCm39) missense possibly damaging 0.73
X0057:Herc2 UTSW 7 55,879,438 (GRCm39) missense probably benign 0.04
X0064:Herc2 UTSW 7 55,841,006 (GRCm39) missense probably benign
X0064:Herc2 UTSW 7 55,840,959 (GRCm39) missense probably benign 0.01
Z1088:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1088:Herc2 UTSW 7 55,737,089 (GRCm39) missense probably benign 0.00
Z1088:Herc2 UTSW 7 55,876,337 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,180 (GRCm39) missense probably damaging 1.00
Z1088:Herc2 UTSW 7 55,865,129 (GRCm39) missense possibly damaging 0.86
Z1176:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1176:Herc2 UTSW 7 55,747,281 (GRCm39) missense possibly damaging 0.48
Z1176:Herc2 UTSW 7 55,782,246 (GRCm39) missense probably damaging 1.00
Z1177:Herc2 UTSW 7 55,781,040 (GRCm39) missense probably benign
Z1177:Herc2 UTSW 7 55,771,337 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGGTCTTTTCCTACTCAAGTTTTCA -3'
(R):5'- CCAGAACCAAAGTCCCAGATTT -3'

Sequencing Primer
(F):5'- GAGTCATTTTTCACTGGTCA -3'
(R):5'- CCCAGATTTTGTTAAACCTGGGGC -3'
Posted On 2015-10-08