Incidental Mutation 'R4667:Akap13'
ID 352035
Institutional Source Beutler Lab
Gene Symbol Akap13
Ensembl Gene ENSMUSG00000066406
Gene Name A kinase anchor protein 13
Synonyms PROTO-LB, Ht31, 5830460E08Rik, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, AKAP-Lbc
MMRRC Submission 042012-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4667 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 75105282-75404357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75378842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2128 (T2128A)
Ref Sequence ENSEMBL: ENSMUSP00000147237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207239] [ENSMUST00000207750]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094307
AA Change: T409A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091865
Gene: ENSMUSG00000066406
AA Change: T409A

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
C1 54 100 1.95e-4 SMART
low complexity region 157 168 N/A INTRINSIC
RhoGEF 260 452 1.28e-61 SMART
PH 494 597 2.94e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147005
AA Change: T2128A

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117686
Gene: ENSMUSG00000066406
AA Change: T2128A

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
internal_repeat_1 485 695 4.85e-5 PROSPERO
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
Pfam:RII_binding_1 1218 1235 4.3e-6 PFAM
low complexity region 1429 1444 N/A INTRINSIC
low complexity region 1479 1501 N/A INTRINSIC
low complexity region 1601 1612 N/A INTRINSIC
low complexity region 1738 1768 N/A INTRINSIC
C1 1773 1819 1.95e-4 SMART
low complexity region 1876 1887 N/A INTRINSIC
RhoGEF 1979 2171 1.28e-61 SMART
PH 2213 2316 2.94e-11 SMART
coiled coil region 2326 2363 N/A INTRINSIC
low complexity region 2411 2430 N/A INTRINSIC
low complexity region 2462 2472 N/A INTRINSIC
coiled coil region 2551 2664 N/A INTRINSIC
low complexity region 2746 2752 N/A INTRINSIC
low complexity region 2758 2771 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166315
AA Change: T2110A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: T2110A

DomainStartEndE-ValueType
low complexity region 174 184 N/A INTRINSIC
low complexity region 773 789 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 1021 1032 N/A INTRINSIC
low complexity region 1433 1448 N/A INTRINSIC
low complexity region 1483 1505 N/A INTRINSIC
low complexity region 1583 1594 N/A INTRINSIC
low complexity region 1720 1750 N/A INTRINSIC
C1 1755 1801 1.95e-4 SMART
low complexity region 1858 1869 N/A INTRINSIC
RhoGEF 1961 2153 1.28e-61 SMART
PH 2195 2298 2.94e-11 SMART
coiled coil region 2308 2345 N/A INTRINSIC
low complexity region 2393 2412 N/A INTRINSIC
low complexity region 2444 2454 N/A INTRINSIC
coiled coil region 2533 2646 N/A INTRINSIC
low complexity region 2728 2734 N/A INTRINSIC
low complexity region 2740 2753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207239
AA Change: T409A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000207750
AA Change: T2128A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad8 A G 9: 26,901,923 (GRCm39) L147P probably damaging Het
Adgra3 T A 5: 50,136,298 (GRCm39) Y729F possibly damaging Het
Ago2 A G 15: 73,018,265 (GRCm39) Y58H probably damaging Het
Ankhd1 C A 18: 36,781,074 (GRCm39) P2042Q possibly damaging Het
Arhgef15 T C 11: 68,845,387 (GRCm39) K155R probably benign Het
Atp10b T C 11: 43,138,345 (GRCm39) F1209L probably damaging Het
B130006D01Rik A T 11: 95,617,335 (GRCm39) probably benign Het
Bmpr2 T C 1: 59,906,875 (GRCm39) L656S probably damaging Het
Bnip5 G T 17: 29,127,287 (GRCm39) Q241K possibly damaging Het
Btbd17 A G 11: 114,684,683 (GRCm39) F119L possibly damaging Het
Ccdc191 G T 16: 43,751,646 (GRCm39) K267N probably damaging Het
Cd200l1 A G 16: 45,264,526 (GRCm39) S11P probably benign Het
Ceacam20 T C 7: 19,719,952 (GRCm39) Y495H probably damaging Het
Celf2 T C 2: 6,726,339 (GRCm39) I47V probably benign Het
Cemip2 G A 19: 21,774,715 (GRCm39) R119H probably benign Het
Cemip2 C T 19: 21,822,145 (GRCm39) A1180V probably benign Het
Chd9 T C 8: 91,760,428 (GRCm39) S2058P possibly damaging Het
Clcn6 T C 4: 148,108,624 (GRCm39) E135G possibly damaging Het
Cntn1 T A 15: 92,192,960 (GRCm39) N687K probably damaging Het
Col1a2 A T 6: 4,512,412 (GRCm39) M99L unknown Het
Cpeb2 T C 5: 43,391,235 (GRCm39) probably benign Het
Csn1s2b A G 5: 87,970,170 (GRCm39) T134A possibly damaging Het
Cst13 A T 2: 148,665,001 (GRCm39) probably benign Het
Cyp2c66 T A 19: 39,165,100 (GRCm39) D360E probably damaging Het
Dhx8 A G 11: 101,628,987 (GRCm39) S179G unknown Het
Dip2b A G 15: 100,049,241 (GRCm39) I212V probably benign Het
Dnah9 G A 11: 66,046,357 (GRCm39) H64Y probably benign Het
Dnal1 T C 12: 84,183,474 (GRCm39) probably benign Het
Dse T G 10: 34,029,008 (GRCm39) Y694S probably damaging Het
Dync2h1 T C 9: 7,051,411 (GRCm39) I3175V probably benign Het
Elf5 A G 2: 103,279,405 (GRCm39) N209D probably damaging Het
Elovl1 A G 4: 118,287,984 (GRCm39) Y40C probably damaging Het
Erp27 T C 6: 136,885,150 (GRCm39) E216G possibly damaging Het
F5 G A 1: 164,001,755 (GRCm39) V153I probably benign Het
Fam186a G A 15: 99,842,413 (GRCm39) T1277I possibly damaging Het
Fam90a1a A T 8: 22,453,362 (GRCm39) H239L possibly damaging Het
Fchsd2 G T 7: 100,899,656 (GRCm39) R334L probably damaging Het
Fermt3 T C 19: 6,980,288 (GRCm39) Y369C probably damaging Het
Fhod3 C T 18: 25,199,395 (GRCm39) P689S probably benign Het
Fnbp1l G T 3: 122,350,216 (GRCm39) Q332K probably benign Het
Frem3 T C 8: 81,390,049 (GRCm39) S1767P probably damaging Het
Ggt5 T C 10: 75,438,865 (GRCm39) L121P probably damaging Het
Gphn T C 12: 78,501,591 (GRCm39) S119P probably damaging Het
Herc2 A G 7: 55,781,001 (GRCm39) D1222G probably damaging Het
Hmx3 T C 7: 131,146,111 (GRCm39) I273T possibly damaging Het
Hnrnpu A G 1: 178,159,746 (GRCm39) probably benign Het
Hspg2 C T 4: 137,266,956 (GRCm39) T1987I possibly damaging Het
Ighv1-22 T A 12: 114,710,071 (GRCm39) Q58L probably damaging Het
Ighv14-3 T A 12: 114,023,875 (GRCm39) I7F probably benign Het
Kcns3 C A 12: 11,141,784 (GRCm39) R305L probably damaging Het
Kcnu1 C T 8: 26,400,949 (GRCm39) A699V possibly damaging Het
Kif22 A C 7: 126,632,500 (GRCm39) L270W probably damaging Het
Lrp2 G T 2: 69,319,642 (GRCm39) H1960Q probably benign Het
Marchf7 C T 2: 60,071,394 (GRCm39) Q94* probably null Het
Mcoln3 A T 3: 145,836,959 (GRCm39) I264F probably benign Het
Mdn1 A C 4: 32,679,572 (GRCm39) T706P probably damaging Het
Mfsd2b A G 12: 4,917,636 (GRCm39) C137R probably benign Het
Mmp25 A G 17: 23,863,581 (GRCm39) V83A probably benign Het
Mocos T C 18: 24,799,491 (GRCm39) Y242H probably benign Het
Msh6 T C 17: 88,292,234 (GRCm39) S330P possibly damaging Het
Mtus2 T C 5: 148,235,070 (GRCm39) S1156P possibly damaging Het
Muc5b G A 7: 141,396,116 (GRCm39) R124H unknown Het
Mybbp1a G A 11: 72,338,797 (GRCm39) E775K possibly damaging Het
Myo10 A G 15: 25,793,239 (GRCm39) E1272G possibly damaging Het
Nars1 A G 18: 64,638,302 (GRCm39) S254P possibly damaging Het
Ncapd2 A G 6: 125,161,481 (GRCm39) I211T possibly damaging Het
Ncoa7 A T 10: 30,566,786 (GRCm39) W582R probably damaging Het
Npr3 T A 15: 11,905,553 (GRCm39) D58V possibly damaging Het
Nr3c1 G T 18: 39,561,780 (GRCm39) T430K probably benign Het
Odf2l A G 3: 144,833,801 (GRCm39) T111A probably benign Het
Ogdh G T 11: 6,290,600 (GRCm39) C406F probably benign Het
Olfml2a T G 2: 38,839,022 (GRCm39) S190A probably damaging Het
Optn T C 2: 5,037,950 (GRCm39) K415E probably benign Het
Or10n1 T C 9: 39,525,034 (GRCm39) M57T probably damaging Het
Or52a20 A G 7: 103,365,845 (GRCm39) T15A probably benign Het
Or8b12i T C 9: 20,082,394 (GRCm39) I158V probably benign Het
Or8g52 G T 9: 39,631,005 (GRCm39) V161F probably benign Het
Pakap A T 4: 57,855,655 (GRCm39) D328V possibly damaging Het
Perm1 C A 4: 156,304,663 (GRCm39) S803* probably null Het
Pex14 T C 4: 149,068,542 (GRCm39) T84A probably benign Het
Pih1d2 T A 9: 50,532,252 (GRCm39) Y103* probably null Het
Pikfyve T A 1: 65,289,432 (GRCm39) C1235S probably damaging Het
Polr1a A G 6: 71,894,805 (GRCm39) N171S probably benign Het
Prrx1 A G 1: 163,081,616 (GRCm39) S201P probably benign Het
Psme2b A T 11: 48,836,493 (GRCm39) N151K probably benign Het
Serpinb5 A T 1: 106,800,025 (GRCm39) T72S probably benign Het
Sgsm1 A G 5: 113,407,913 (GRCm39) probably null Het
Sipa1l2 T C 8: 126,180,209 (GRCm39) R1063G possibly damaging Het
Slc19a3 T C 1: 83,000,520 (GRCm39) T166A probably benign Het
Slc5a4b T C 10: 75,910,879 (GRCm39) Y319C possibly damaging Het
Stard3nl T A 13: 19,560,689 (GRCm39) N29Y probably damaging Het
Sult6b2 G T 6: 142,747,421 (GRCm39) C109* probably null Het
Tcf25 A G 8: 124,123,764 (GRCm39) E467G possibly damaging Het
Tmem177 A T 1: 119,837,950 (GRCm39) V243D probably benign Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Tspan11 T A 6: 127,920,678 (GRCm39) C208* probably null Het
Ttc1 A G 11: 43,636,144 (GRCm39) V33A probably benign Het
Tut4 G A 4: 108,352,356 (GRCm39) E357K probably damaging Het
Uck1 T A 2: 32,146,046 (GRCm39) H283L probably damaging Het
Utrn A C 10: 12,573,797 (GRCm39) V1091G probably benign Het
Vmn1r11 A T 6: 57,114,483 (GRCm39) H49L probably damaging Het
Vmn1r160 G T 7: 22,571,478 (GRCm39) S277I probably benign Het
Vmn1r18 A T 6: 57,367,069 (GRCm39) S162T probably benign Het
Vps37b A G 5: 124,148,795 (GRCm39) L80P probably damaging Het
Wfdc3 T C 2: 164,585,006 (GRCm39) M1V probably null Het
Wrn A T 8: 33,814,366 (GRCm39) N116K probably benign Het
Wscd2 G T 5: 113,715,333 (GRCm39) G391V probably damaging Het
Zfp286 A G 11: 62,671,428 (GRCm39) V215A probably benign Het
Zfp568 A G 7: 29,722,702 (GRCm39) H549R probably damaging Het
Other mutations in Akap13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Akap13 APN 7 75,375,719 (GRCm39) missense probably damaging 0.99
IGL00332:Akap13 APN 7 75,378,667 (GRCm39) missense probably damaging 1.00
IGL00481:Akap13 APN 7 75,373,643 (GRCm39) missense probably damaging 1.00
IGL00590:Akap13 APN 7 75,260,417 (GRCm39) missense probably benign 0.01
IGL00655:Akap13 APN 7 75,354,146 (GRCm39) missense probably damaging 0.99
IGL00766:Akap13 APN 7 75,354,260 (GRCm39) missense probably damaging 0.96
IGL00818:Akap13 APN 7 75,259,475 (GRCm39) missense probably benign 0.00
IGL00826:Akap13 APN 7 75,327,195 (GRCm39) missense probably damaging 1.00
IGL01014:Akap13 APN 7 75,400,381 (GRCm39) utr 3 prime probably benign
IGL01090:Akap13 APN 7 75,316,279 (GRCm39) missense probably benign 0.44
IGL01155:Akap13 APN 7 75,219,684 (GRCm39) missense probably damaging 1.00
IGL01326:Akap13 APN 7 75,375,096 (GRCm39) missense probably benign 0.30
IGL01456:Akap13 APN 7 75,252,595 (GRCm39) missense probably damaging 0.98
IGL01460:Akap13 APN 7 75,397,594 (GRCm39) missense probably benign 0.29
IGL01568:Akap13 APN 7 75,258,270 (GRCm39) nonsense probably null 0.00
IGL01610:Akap13 APN 7 75,397,353 (GRCm39) missense probably damaging 1.00
IGL01610:Akap13 APN 7 75,369,928 (GRCm39) missense possibly damaging 0.71
IGL01615:Akap13 APN 7 75,347,141 (GRCm39) missense probably damaging 1.00
IGL01667:Akap13 APN 7 75,219,767 (GRCm39) missense probably damaging 1.00
IGL01705:Akap13 APN 7 75,396,515 (GRCm39) missense possibly damaging 0.86
IGL02070:Akap13 APN 7 75,316,293 (GRCm39) missense probably benign 0.27
IGL02269:Akap13 APN 7 75,252,659 (GRCm39) missense probably benign
IGL02421:Akap13 APN 7 75,367,554 (GRCm39) missense possibly damaging 0.66
IGL02870:Akap13 APN 7 75,258,936 (GRCm39) missense probably damaging 0.96
IGL02944:Akap13 APN 7 75,258,405 (GRCm39) missense probably benign
IGL03051:Akap13 APN 7 75,260,233 (GRCm39) nonsense probably null
IGL03160:Akap13 APN 7 75,380,165 (GRCm39) missense probably damaging 1.00
IGL03245:Akap13 APN 7 75,259,500 (GRCm39) missense probably damaging 0.99
R0254:Akap13 UTSW 7 75,386,352 (GRCm39) splice site probably benign
R0310:Akap13 UTSW 7 75,264,678 (GRCm39) missense probably damaging 0.99
R0373:Akap13 UTSW 7 75,380,248 (GRCm39) missense probably damaging 1.00
R0373:Akap13 UTSW 7 75,259,677 (GRCm39) missense probably benign 0.00
R0408:Akap13 UTSW 7 75,396,544 (GRCm39) missense probably damaging 1.00
R0631:Akap13 UTSW 7 75,264,744 (GRCm39) missense probably damaging 0.99
R0646:Akap13 UTSW 7 75,397,494 (GRCm39) missense probably damaging 1.00
R0781:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R0845:Akap13 UTSW 7 75,375,128 (GRCm39) missense probably damaging 1.00
R1004:Akap13 UTSW 7 75,337,034 (GRCm39) missense probably damaging 0.99
R1024:Akap13 UTSW 7 75,327,157 (GRCm39) missense probably damaging 1.00
R1110:Akap13 UTSW 7 75,261,125 (GRCm39) missense possibly damaging 0.56
R1346:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1349:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1372:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1387:Akap13 UTSW 7 75,235,941 (GRCm39) missense probably damaging 0.97
R1442:Akap13 UTSW 7 75,385,526 (GRCm39) missense probably damaging 0.99
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1466:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1584:Akap13 UTSW 7 75,378,797 (GRCm39) missense possibly damaging 0.79
R1696:Akap13 UTSW 7 75,259,340 (GRCm39) missense possibly damaging 0.67
R1738:Akap13 UTSW 7 75,326,942 (GRCm39) missense probably damaging 1.00
R1773:Akap13 UTSW 7 75,333,199 (GRCm39) missense possibly damaging 0.80
R1785:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1786:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R1791:Akap13 UTSW 7 75,260,783 (GRCm39) missense probably benign 0.00
R1819:Akap13 UTSW 7 75,258,453 (GRCm39) missense probably benign 0.04
R1879:Akap13 UTSW 7 75,260,475 (GRCm39) missense probably benign 0.01
R1989:Akap13 UTSW 7 75,354,264 (GRCm39) missense probably benign 0.01
R2016:Akap13 UTSW 7 75,354,279 (GRCm39) missense probably damaging 0.99
R2092:Akap13 UTSW 7 75,260,318 (GRCm39) missense probably benign 0.05
R2126:Akap13 UTSW 7 75,375,052 (GRCm39) missense possibly damaging 0.95
R2131:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2132:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2133:Akap13 UTSW 7 75,261,182 (GRCm39) missense probably benign 0.16
R2251:Akap13 UTSW 7 75,389,225 (GRCm39) missense possibly damaging 0.50
R3704:Akap13 UTSW 7 75,316,298 (GRCm39) missense probably damaging 1.00
R3713:Akap13 UTSW 7 75,235,929 (GRCm39) missense probably damaging 0.98
R3731:Akap13 UTSW 7 75,261,125 (GRCm39) missense probably benign 0.39
R3765:Akap13 UTSW 7 75,258,585 (GRCm39) missense probably benign 0.04
R3788:Akap13 UTSW 7 75,351,901 (GRCm39) critical splice donor site probably null
R3793:Akap13 UTSW 7 75,259,889 (GRCm39) missense probably benign 0.00
R3970:Akap13 UTSW 7 75,219,699 (GRCm39) nonsense probably null
R4205:Akap13 UTSW 7 75,260,667 (GRCm39) missense probably benign 0.05
R4257:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R4374:Akap13 UTSW 7 75,258,732 (GRCm39) missense probably damaging 0.96
R4448:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4450:Akap13 UTSW 7 75,392,508 (GRCm39) missense probably damaging 1.00
R4457:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4458:Akap13 UTSW 7 75,389,213 (GRCm39) missense probably damaging 0.99
R4466:Akap13 UTSW 7 75,252,521 (GRCm39) splice site probably null
R4632:Akap13 UTSW 7 75,316,301 (GRCm39) missense possibly damaging 0.91
R4669:Akap13 UTSW 7 75,378,842 (GRCm39) missense probably damaging 1.00
R4671:Akap13 UTSW 7 75,229,312 (GRCm39) nonsense probably null
R4821:Akap13 UTSW 7 75,327,255 (GRCm39) intron probably benign
R4868:Akap13 UTSW 7 75,393,252 (GRCm39) missense probably damaging 1.00
R4894:Akap13 UTSW 7 75,375,068 (GRCm39) missense possibly damaging 0.76
R4943:Akap13 UTSW 7 75,398,988 (GRCm39) missense probably benign 0.22
R4962:Akap13 UTSW 7 75,399,178 (GRCm39) missense probably damaging 0.98
R4988:Akap13 UTSW 7 75,380,276 (GRCm39) missense probably damaging 1.00
R5119:Akap13 UTSW 7 75,337,000 (GRCm39) missense probably damaging 0.98
R5141:Akap13 UTSW 7 75,259,362 (GRCm39) missense probably benign 0.18
R5419:Akap13 UTSW 7 75,259,991 (GRCm39) missense probably benign 0.01
R5427:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R5429:Akap13 UTSW 7 75,252,652 (GRCm39) missense possibly damaging 0.70
R5432:Akap13 UTSW 7 75,252,578 (GRCm39) missense probably damaging 1.00
R5458:Akap13 UTSW 7 75,236,049 (GRCm39) missense probably damaging 1.00
R5636:Akap13 UTSW 7 75,354,120 (GRCm39) missense probably damaging 0.96
R5643:Akap13 UTSW 7 75,351,902 (GRCm39) critical splice donor site probably null
R5898:Akap13 UTSW 7 75,378,894 (GRCm39) missense probably damaging 1.00
R5932:Akap13 UTSW 7 75,259,932 (GRCm39) missense probably damaging 1.00
R6135:Akap13 UTSW 7 75,259,656 (GRCm39) missense possibly damaging 0.94
R6137:Akap13 UTSW 7 75,327,164 (GRCm39) missense probably damaging 1.00
R6182:Akap13 UTSW 7 75,236,028 (GRCm39) missense probably benign 0.45
R6310:Akap13 UTSW 7 75,398,941 (GRCm39) missense probably damaging 0.99
R6346:Akap13 UTSW 7 75,335,002 (GRCm39) missense probably damaging 1.00
R6466:Akap13 UTSW 7 75,376,792 (GRCm39) missense probably benign 0.01
R6605:Akap13 UTSW 7 75,229,516 (GRCm39) missense probably damaging 0.98
R6617:Akap13 UTSW 7 75,380,111 (GRCm39) missense possibly damaging 0.95
R6621:Akap13 UTSW 7 75,219,729 (GRCm39) missense probably damaging 1.00
R6703:Akap13 UTSW 7 75,252,646 (GRCm39) missense probably damaging 1.00
R6750:Akap13 UTSW 7 75,389,206 (GRCm39) missense probably benign 0.03
R7069:Akap13 UTSW 7 75,260,010 (GRCm39) missense probably benign 0.29
R7116:Akap13 UTSW 7 75,369,943 (GRCm39) missense probably benign 0.00
R7158:Akap13 UTSW 7 75,229,342 (GRCm39) missense probably damaging 0.97
R7159:Akap13 UTSW 7 75,380,327 (GRCm39) missense possibly damaging 0.72
R7467:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7468:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7471:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7472:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7477:Akap13 UTSW 7 75,398,995 (GRCm39) missense probably benign
R7636:Akap13 UTSW 7 75,259,621 (GRCm39) missense probably benign 0.04
R7650:Akap13 UTSW 7 75,293,202 (GRCm39) missense probably benign 0.20
R7671:Akap13 UTSW 7 75,219,648 (GRCm39) missense probably damaging 1.00
R7681:Akap13 UTSW 7 75,378,544 (GRCm39) missense possibly damaging 0.91
R7752:Akap13 UTSW 7 75,327,006 (GRCm39) missense possibly damaging 0.74
R7784:Akap13 UTSW 7 75,260,076 (GRCm39) missense probably benign 0.00
R7816:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7817:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R7834:Akap13 UTSW 7 75,392,390 (GRCm39) missense possibly damaging 0.85
R7880:Akap13 UTSW 7 75,235,964 (GRCm39) missense probably damaging 0.97
R7942:Akap13 UTSW 7 75,261,218 (GRCm39) missense possibly damaging 0.50
R8006:Akap13 UTSW 7 75,229,444 (GRCm39) missense probably damaging 1.00
R8009:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8011:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8012:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8013:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8016:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8089:Akap13 UTSW 7 75,260,340 (GRCm39) missense possibly damaging 0.94
R8138:Akap13 UTSW 7 75,351,979 (GRCm39) splice site probably null
R8174:Akap13 UTSW 7 75,378,617 (GRCm39) missense possibly damaging 0.89
R8298:Akap13 UTSW 7 75,397,552 (GRCm39) missense probably damaging 1.00
R8444:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8445:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8465:Akap13 UTSW 7 75,376,786 (GRCm39) missense probably benign 0.11
R8512:Akap13 UTSW 7 75,260,834 (GRCm39) missense probably damaging 0.99
R8523:Akap13 UTSW 7 75,380,213 (GRCm39) missense probably damaging 1.00
R8793:Akap13 UTSW 7 75,375,076 (GRCm39) missense probably benign 0.35
R8907:Akap13 UTSW 7 75,260,456 (GRCm39) missense probably damaging 0.99
R8907:Akap13 UTSW 7 75,260,444 (GRCm39) missense probably benign 0.08
R8928:Akap13 UTSW 7 75,259,606 (GRCm39) missense probably benign 0.00
R8929:Akap13 UTSW 7 75,258,752 (GRCm39) missense probably benign 0.00
R8937:Akap13 UTSW 7 75,184,601 (GRCm39) critical splice donor site probably null
R8967:Akap13 UTSW 7 75,378,882 (GRCm39) missense possibly damaging 0.80
R8986:Akap13 UTSW 7 75,259,074 (GRCm39) missense probably benign
R9152:Akap13 UTSW 7 75,261,033 (GRCm39) missense probably damaging 0.98
R9153:Akap13 UTSW 7 75,259,229 (GRCm39) missense probably benign 0.00
R9160:Akap13 UTSW 7 75,385,526 (GRCm39) missense possibly damaging 0.88
R9192:Akap13 UTSW 7 75,354,249 (GRCm39) missense probably benign 0.06
R9319:Akap13 UTSW 7 75,258,836 (GRCm39) missense probably benign 0.01
R9513:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9515:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9516:Akap13 UTSW 7 75,354,275 (GRCm39) missense probably benign 0.01
R9523:Akap13 UTSW 7 75,293,193 (GRCm39) missense
R9564:Akap13 UTSW 7 75,259,161 (GRCm39) missense probably benign
R9621:Akap13 UTSW 7 75,386,090 (GRCm39) missense probably benign 0.09
R9686:Akap13 UTSW 7 75,236,084 (GRCm39) missense probably damaging 1.00
Z1176:Akap13 UTSW 7 75,380,300 (GRCm39) missense probably damaging 0.99
Z1177:Akap13 UTSW 7 75,264,753 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTGACCTGAAACGCAAGCG -3'
(R):5'- GTGCCTCAACACCTGTAATCTC -3'

Sequencing Primer
(F):5'- AAGCGTCCCCATCATGGTCAG -3'
(R):5'- GGAACTCACTTTGTAGTCCAGGC -3'
Posted On 2015-10-08